Synergistic Interaction of Salicylic Acid and Ciprofloxacin against...

[Full title: Synergistic Interaction of Salicylic Acid and Ciprofloxacin against Escherichia coli, Staphylococcus aureus, Pseudomonas aeruginosa, Klebsiella pneumoniae and Serratia marcescens]

[Find the meaning and references behind the names: Files, Cip, Doi, Abdullah, Key, Int, Deals, Present, Time, Arabia, Fici, Mic, Original, Exceptional, Data, Under, Coli, Violet, Acid, Member, Open, Mbc, Crystal, Author, Strong]

OPEN ACCESS International Journal of Pharmacology ISSN 1811-7775 DOI: 10.3923/ijp.2024.660.671 Research Article Synergistic Interaction of Salicylic Acid and Ciprofloxacin against Escherichia coli , Staphylococcus aureus , Pseudomonas aeruginosa , Klebsiella pneumoniae and Serratia marcescens Almonther Abdullah Hershan Department of Medical Microbiology and Parasitology, College of Medicine, University of Jeddah, Jeddah, Saudi Arabia Abstract Background and Objective: Salicylic acid (SA), a notable member of phytoconstituents is known to possess remarkable antibacterial potential. The present investigation deals with the synergistic interaction of salicylic acid and ciprofloxacin (CIP), evaluating their antibacterial potential against Escherichia coli , Staphylococcus aureus , Pseudomonas aeruginosa , Klebsiella pneumoniae and Serratia marcescens . Materials and Methods: The antibacterial potential of CIP, SA and a combination of CIP and SA was validated by MIC, MBC, broth checkerboard method, biofilm inhibition by crystal violet assay, membrane stability and time-kill kinetics. Expression levels of genetic markers such as lasB, MrkA and bsmB in P. aeruginosa , K. pneumoniae and S. marcescens , respectively were analyzed using PCR Results: The MIC and MBC of E. coli and S. aureus of CIP was 5 µg/mL and for SA it was found to be 5 mg/mL for all the two microbes Escherichia coli and Staphylococcus aureus tend to be resistant to SA. The combination of CIP and SA showed exceptional antibacterial capability toward P. aeruginosa , K. pneumoniae and S. marcescens . In the checkerboard assay, K. pneumoniae exhibited a partial synergistic effect with a FICI value of 0.502. Serratia marcescens and P. aeruginosa with FICI values of 0.49 and 0.48, respectively demonstrated synergistic action. The combination of CIP and SA effectively inhibits biofilm formation in P. aeruginosa , K. pneumoniae and S. marcescens in crystal violet assay. From membrane stability, it can be found that the combination of CIP and SA causes destabilization of the outer membrane of tested microbes. The results of the time-kill assay demonstrated that the combination of CIP and SA remarkably inhibited the proliferation of the tested bacterial population. The combination of CIP and SA exhibited significant downregulation of lasB, MrkA and bsmB. Conclusion: The combination of CIP and SA exerts enhanced antibacterial capability against tested microbes compared to CIP and SA alone. The antibacterial efficacy was greater against P. aeruginosa than against K. pneumoniae and S. marcescens Key words: Synergy, ciprofloxacin, salicylic acid, antibacterial activity, phytoconstituents Citation: Hershan, A.A., 2024. Synergistic interaction of salicylic acid and ciprofloxacin against Escherichia coli, Staphylococcus aureus, Pseudomonas aeruginosa, Klebsiella pneumoniae and Serratia marcescens. Int. J. Pharmacol., 20: 660-671 Corresponding Author: Almonther Abdullah Hershan, Department of Medical Microbiology and Parasitology, College of Medicine, University of Jeddah, Jeddah, Saudi Arabia Copyright: © 2024 Almonther Abdullah Hershan. This is an open access article distributed under the terms of the creative commons attribution License, which permits unrestricted use, distribution and reproduction in any medium, provided the original author and source are credited. Competing Interest: The author has declared that no competing interest exists Data Availability: All relevant data are within the paper and its supporting information files.

[Find the meaning and references behind the names: Mode, Natural, Range, Deal, Class, June, Human, Work, Broad, Date, Ring, Fadwa, Rid, Great, Development, December, Novel, Lack, Hrs, Gram, Get, Vis, Plate, Mhb, Area, Cell, Alpha, Knowledge, Stock, Lower, Study, Min, Positive, Need]

Int. J. Pharmacol., 20 (4): 660-671, 2024 INTRODUCTION The antimicrobial drug resistance has created greater demand for the need of antimicrobial against infection causing pathogens 1 . Because of their exceptional capacity for environmental adaptation, bacteria can survive at clinically relevant quantities of currently available antibiotics, which leads to the selection of resistant strains. The utilization of phytochemicals as a substitute for current antimicrobials appears to have surged recently 2 . The natural compounds typically exhibit lower antibacterial activity than conventional antibiotics; hence, it is challenging for them to successfully substitute existing antibiotic in clinical applications. But it has been demonstrated that certain antimicrobial substances originating from plants might increase antibiotic action in a synergistic effect. The combination of naturally occurring compounds with commercially available antibiotics can work synergistically to reduce the minimum inhibitory concentration (MIC) of both the antibiotics and the natural product, potentially making it as effective as the antibiotic alone 3,4 Salicylic acid (SA), is a phenolic acid constituent that has functional derivatives with an aromatic ring connected to a hydroxyl group and is also a well-known representative in the class of phytoconstituents that have positive impacts on human health 5 . Several studies showed the anti-inflammatory activity of SA and it also possesses antibacterial activity with minimal toxicity 6 . Salicylic acid and other phenolic compounds may interact with the proteins in bacterial cell membranes resulting in a lack of chemiosmotic control and eventually cell death 7 . It is also linked to synthesis of components that contribute to bacterial virulence and to decrease in resistance to a range of antimicrobial 8,9 Ciprofloxacin (CIP), a fluorinated quinolone, exhibits antibacterial action against a broad range of bacterial species among all the more recent quinolones that have been commercialized to date. The mode of action of ciprofloxacin involves the targeting of alpha subunits of DNA gyrase thereby preventing the supercoiling of bacterial DNA which ultimately results in the termination of replication 10 A great deal of recent investigations on antimicrobials have been concentrated on the development of novel antimicrobial agents or their individual compounds. Nonetheless, there is limited knowledge regarding the underlying mechanism of synergistic antibacterial effects. It has been proven that employing natural compounds and phytoconstituents in combination with antimicrobial agents significantly improves antibacterial efficacy compared to using solely natural compounds or antimicrobial agents. Within this framework of synergistic activity, the present investigation is one of the novel approaches involved in testing the antimicrobial capability of CIP and SA alone and in combination with CIP and SA against different gram-negative and gram-positive bacteria MATERIALS AND METHODS Study area: The study was carried out at University of Jeddah, College of Medicine, Department of Medical Microbiology and Parasitology, Jeddah, Saudi Arabia from June to December 2023 MIC and MBC: The MIC of CIP, SA alone and the combination of CIP and SA were determined by CLSI MO 7-A 9 11 . The E. coli , S. aureus , P. aeruginosa , K. pneumoniae and S. marcescens were cultured in the MHB separately and absorbance was adjusted to 0.1-0.4 at 600 nm. The SA was added in serially two-fold dilution. The tested microbes alone in the MHB without SA were used as control and then incubated for 24 hrs at 37 E C. The apparent turbidity in each well was analyzed Following this, the plates were observed in a UV-Vis spectrophotometer at 600 nm. The same protocol was performed for CIP. The MIC denotes the minimal concentration of SA and CIP that visibly inhibits bacterial growth. The minimal concentration of SA and CIP that completely inhibits bacterial growth is referred to as MBC Broth checkerboard method: Using the broth microdilution method, two-dimensional checkerboard titrations were carried out, where the concentration of SA decreased vertically and the concentration of antibiotic (CIP) decreased horizontally. The antibiotic stock solution preparation, SA suspension preparation and further steps were followed as performed in Fadwa et al 12 . The Fractional Inhibitory Concentration Index (FICI) was computed from the formula to ascertain the association between the two drugs. The interpretation ranges were followed for interpreting the FICI value as mentioned in Fadwa et al 12 Crystal violet assay: The crystal violet assay was used for evaluating biofilm growth in accordance with the earlier steps were carried out with slight modifications. After carefully emptying each well, the plate was washed using a sterile saline solution to get rid of cells which do not adhere. For 15 min, each well was incubated after 200 µL of pure methanol was introduced. After removing the methanol and completely drying the plates at RT, 200 µL of 0.5% crystal violet was applied and kept for 15 min. Following this, the 661

[Find the meaning and references behind the names: De Oliveira, Wells, Every, Sds, Fig, Pellet, Reader, Gene, Final, Set, Stain, Live, Forward, Gel, Sec, Manner, Reddy, Mean, Given, Table, Negreiros, Pre, Oliveira]

Int. J. Pharmacol., 20 (4): 660-671, 2024 stain was removed and the wells were dried and rinsed with water. After this, each well received 200 µL of 95% ethanol. The absorbance was measured utilizing a Biotek microplate reader at OD 450. Eradication of biofilm was verified using the formula given by de Oliveira Negreiros et al 13 Membrane stability: Membrane stability was performed in accordance to Reddy et al 14 . The antibacterial potential of CIP, SA alone and combination of CIP and SA on the outer membrane of the tested microbes P. aeruginosa , K pneumoniae and S. marcescens was evaluated by SDS treatment of pre-treated cells (with CIP, SA alone and combination of CIP and SA). Live cultures of tested microbes were mixed in PBS buffer containing different concentrations of CIP, SA and a combination of CIP and SA, then incubated for 30 mins. After centrifuging the cells, the pellet was combined with the equivalent amount of PBS. Following this, SDS (0.15%) was mixed in CIP, SA alone and a combination of CIP and SA treated cells. For every 2 min, absorbance was measured at 565 nm Time-kill kinetics assay: Time-kill kinetics studies have been used to analyse several antimicrobial drugs and are also the basis for in vitro investigations on pharmacodynamic medication interactions. The MHB was inoculated with tested organisms (5×10 6 -1×10 7 CFU) with various concentrations of CIP, SA alone and a combination of CIP and SA for all the tested organisms and analysed for survival at 0, 4, 8, 12 and 24 th hrs. The UV-Vis spectrophotometer evaluated bacterial growth inhibition at 600 nm. The absorbance was measured and assessed statistically 15 Gene expression studies on lasB, MrkA and bsmB: The DNA from P. aeruginosa , K. pneumoniae and S. marcescens isolates was extracted by the phenol-chloroform method. The lasB, MrkA and bsmB were amplified by PCR (Takara). The lasB (Forward: GGAATGAACGAGGCGTTCTC & Reverse: GGTCCAGTAGTAAGCGGTTGG), MrkA (Forward: CACCAAACAG GATGATGTGAG & Reverse: CGCATAGCCGACGTAGTAAG) and bsmB (Forward: CCGCCTGCAAGAAAGAACTT & Reverse: AGAGATCGACGGTCAGTTCC). The initial denaturation condition was set at 95 E C for 2 min, followed by 95 E C for 1 min. The annealing temperatures of lasB, MrkA and bsmB are 55.6 E C, 56.8 E C and 56.8 E C, respectively for 30 sec The extension cycle was set at 72 E C for 1 min, followed by the final extension at 72 E C for 5 min. The final products of PCR were loaded onto 1.0% agarose gel with EtBr and electrophoresis was performed. The results were visualized under UV transilluminator (UV-3,600 Shimadzu, Japan) Statistical analysis: The statistical evaluation was conducted utilizing version 8.1 of GraphPad Prism. Each experiment was carried out twice and one-way ANOVA was applied to assess the outcomes. To compare the treatment and control groups, Tukeyʼs multiple comparison test was employed. Data are represented as Mean±SD. The p<0.0001 was denoted as significant RESULTS MIC and MBC: The MIC and MBC of E. coli and S. aureus of CIP was 5 µg/mL and for SA it was 5 mg/mL for E. coli and S. aureus . Both microbes were found to be resistant and exhibited uncontrolled growth to SA, hence for further parameters both microbes were eliminated. The CIP and SA had inhibitory effects on P. aeruginosa , K. pneumoniae and S. marcescens . The MIC and MBC of CIP for P. aeruginosa , K. pneumoniae and S. marcescens were depicted in Fig. 1(a-c) and Fig. 2(a-c) and Table 1. In the same manner, MIC and MBC of SA for P. aeruginosa , K. pneumoniae and S. marcescens were demonstrated in Fig. 3(a-c) and Fig. 4(a-c) and Table 2 Broth checkerboard assay: In broth checkerboard assay, for K. pneumoniae , the synergistic effect was partially observed, with a FICI value of 0.502. With FICI values of 0.48 and 0.49, respectively, the combination of CIP and SA demonstrated synergistic interaction for P. aeruginosa and S. marcescens The findings of the checkerboard assay were represented in Table 3 Crystal violet assay: After treating P. aeruginosa with a combination of CIP and SA at the dosage of 0.019 µg/mL and Table 1: MIC and MBC of P. aeruginosa , K. pneumoniae and S. marcescens for CIP Microbe MIC (µg/mL) MBC (µg/mL) P. aeruginosa 0.078 0.15 K. pneumoniae 1.25 2.5 S. marcescens 2.5 5 Table 2: MIC and MBC of P. aeruginosa , K. pneumoniae and S. marcescens for SA Microbe MIC (µg/mL) MBC (µg/mL) P. aeruginosa 400 800 K. pneumoniae 500 1000 S. marcescens 500 1000 Table 3: Type of interaction for the combination of CIP and SA towards P. aeruginosa , K. pneumoniae and S. marcescens in broth checkerboard assay Microbe CIP+SA (µg/mL) Type of interaction P. aeruginosa (FICI) 0.48 Synergy K. pneumoniae (FICI) 0.502 Partial synergy S. marcescens (FICI) 0.49 Synergy 662

[Find the meaning and references behind the names: Wise, Dose, Excellent, Genes, Wall, Case]

Int. J. Pharmacol., 20 (4): 660-671, 2024 Fig. 1(a-c): MIC of CIP towards (a) Pseudomonas aeruginosa , (b) Klebsiella pneumoniae and (c) Serratia marcescens in a dose-wise manner 100 µg/mL, respectively, the biofilm development was eliminated. For K. pneumoniae , the combination of CIP and SA at the dosage of 0.312 and 125 µg/mL, respectively showed excellent biofilm inhibition. For S. marcescens , CIP and SA (0.62 and 125 µg/mL) showed biofilm inhibition. The biofilm inhibition of P. aeruginosa , K. pneumoniae and S. marcescens was depicted in Fig. 5-7 Membrane stability: The results of membrane stability were represented in Fig. 8-10. The treatment with the combination of CIP and SA destabilizes the outer membrane of tested microbes. The CIP and SA at the dosage of 0.019 and 100 µg/mL, respectively disrupted the cell membrane of P. aeruginosa which gradually decreased on increasing time For K. pneumoniae , the combination of CIP and SA in the range of 0.312 and 125 µg/mL, respectively showed rupturing of the cell wall. For S. marcescens , CIP and SA (0.62 and 125 µg/mL) cause leakage of cellular contents Time kill kinetics assay: The findings of the time-kill kinetics assay revealed that all three tested microbes were found to be highly sensitive to the combination of CIP and SA than CIP and SA alone. At 24 th hrs, the growth was completely inhibited for all three microorganisms after treatment with the combination of CIP and SA. Figure 11-13 depicted the time-kill kinetics of P. aeruginosa , K. pneumoniae and S. marcescens Gene expression studies on lasB, MrkA and bsmB: The PCR has been employed for assessing the gene expression profile of lasB (Elastase) in P. aeruginosa , MrkA in K. pneumoniae and bsmB in S. marcescens was depicted in Fig. 14 The combination of CIP and SA demonstrated a noticeable downregulation of lasB in P. aeruginosa in comparison to CIP and SA alone. For K. pneumoniae , the expression of MrkA had been negatively regulated after being subjected to the CIP, SA and a combination of CIP and SA. The expression of bsmB was also downregulated in S. marcescens after treatment with CIP, SA and a combination of CIP and SA. The same pattern was observed for the other two genes in the case of K. pneumoniae and S. marcescens , the combination of CIP and SA demonstrated remarkable downregulation in comparison with CIP and SA alone 663 Inhibition (%) 0.0047 0.009 0.019 0.039 0.078 0.156 Minimum inhibitory concentration Dose concentration (µg/mL) 120 100 80 60 40 20 0 (a) Inhibition (%) 0.039 0.078 0.156 0.312 0.625 1.25 Minimum inhibitory concentration Dose concentration (µg/mL) 120 100 80 60 40 20 0 (b) 2.5 5 Inhibition (%) 0.039 0.078 0.15 0.31 0.625 1.25 Minimum inhibitory concentration Dose concentration (µg/mL) 120 100 80 60 40 20 0 (c) 2.5 5

[Find the meaning and references behind the names: Sharp, Rise]

Int. J. Pharmacol., 20 (4): 660-671, 2024 Fig. 2(a-c): MBC of CIP towards (a) P. aeruginosa , (b) K. pneumoniae and (c) S. marcescens in a dose-wise manner DISCUSSION The application of phytochemicals as a substitute for conventional antimicrobials has seen a sharp rise in recent times. The SA is one of the well-known phenolic acid compounds with antibacterial action. The current study deals with the antibacterial potential of SA along with their synergistic capability with CIP against E. coli , S. aureus , P. aeruginosa , K. pneumoniae and S. marcescens . The E. coli and S. aureus were resistant with MIC of 5 µg/mL for CIP and 5 mg/mL for SA. In previous work, salicylic acid microcapsules exhibited MIC and MBC of 4 mg/mL toward E. coli and S. aureus 16 . Hence further studies were performed on P. aeruginosa , K. pneumoniae and S. marcescens . The MIC of P. aeruginosa , K. pneumoniae and S. marcescens was 0.078, 1.25 and 2.5 µg/mL, respectively for CIP. The MBC was 0.15, 2.5 and 5 µg/mL for the same microbes against CIP. For SA, P. aeruginosa , K. pneumoniae and S. marcescens had MIC values of 400, 500 and 500 µg/mL, respectively. The MBC for SA, P. aeruginosa , K. pneumoniae and S. marcescens had 800, 1000 and 1000 µg/mL, respectively. The MIC and MBC values of CIP and SA for the tested microbes in the present study are in correlation with previously available literature 1,17 . In current investigation, the impact of the combination of CIP and SA was evaluated using the checkerboard assay and FICI was computed by assessing the degree of interaction between CIP and SA against P. aeruginosa , K. pneumoniae and S. marcescens . The synergistic impact was partial for K. pneumoniae with a FICI value of 0.502. The combination of CIP and SA demonstrated synergistic interaction against P. aeruginosa and S. marcescens with FICI values of 0.48 and 0.49, respectively. The results strongly suggested that both CIP and SA synergistically had excellent antibacterial activity Furthermore, in the crystal violet assay, there was a notable variation in the biofilm development by bacteria subjected to CIP, SA and combination of CIP and SA, in comparison with the control. For P. aeruginosa , compared to CIP and SA alone, the combination of the CIP and SA (0.019 µg/mL and 100 µg/mL, respectively) demonstrated nearly complete biofilm eradication. The same pattern of biofilm inhibition was observed for the other two microbes. For K. pneumoniae , CIP and SA at the dosage of 0.312 µg/mL 664 (a) (b) (c) (a) (b) (c) (a) (b) (c) Serratia marcescens : (a) 1.25 µg/mL, (b) 2.5 µg/mL (MIC) and (c) 5 µg/mL (MBC) , respectively Klebsiella pneumoniae : (a) 0.625 µg/mL, (b) 1.25 µg/mL (MIC) and (c) 2.5 µg/mL (MBC) , respectively Pseudomonas aeruginosa : (a) 0.039 µg/mL, (b) 0.078 µg/mL (MIC) and (c) 0.156 µg/mL (MBC), respectively

[Find the meaning and references behind the names: Leak, Vital, Ability, State]

Int. J. Pharmacol., 20 (4): 660-671, 2024 Fig. 3(a-c): MIC of SA towards (a) Pseudomonas aeruginosa , (b) Klebsiella pneumoniae and (c) Serratia marcescens in a dose-wise manner and 125 µg/mL, respectively showed exceptional biofilm inhibition. For S. marcescens , CIP and SA at the dosage of 0.62 and 125 µg/mL, respectively showed outstanding biofilm inhibition. The earlier studies showed that the phenolic compounds, especially at higher doses, can influence biofilm formation by affecting quorum sensing, motility and adhesion structures, which are vital for the development of biofilms 4 A healthy state of the cell membrane is crucial for the proliferation and metabolism of bacteria. The outcomes of the membrane stability revealed that the treatment with the combination of CIP and SA for all three microbes exhibited destabilization of the outer membrane. Following exposure to CIP, SA and the combination of CIP and SA at different intervals of time, there was a gradual release of proteins from the tested microorganisms as it was monitored by the detection of absorbance in the range of 565 nm. Based on these data, it was evident that the combination of CIP and SA ruined the integrity of the bacterial cell membrane, possibly resulting in cellular death. Studies revealed that phenolic acid compounds can interact with the bacterial cell membrane, causing the cell wall to rupture and the intracellular macromolecules like proteins and nucleic acids to leak out. On cascading effect, damage to the cell wall reduces the cellʼs ability to withstand adverse circumstances and other environmental factors leading to cell death 4 . Moreover, time kill assay was conducted further to examine the antibacterial potential of CIP, SA and combination of CIP and SA. The results demonstrated that P. aeruginosa , K. pneumoniae and S. marcescens were gradually killed during treatment From the findings, it can be noted that the combination of CIP and SA exhibited prompt bactericidal effect which ultimately resulted in the reduction of bacterial population at 24 th hrs Phenolic acid compounds can deteriorate the inner cell membrane of bacteria by associating with the proteins of the cell membrane, which impairs chemiosmotic regulation and eventually culminates in cell death 4 Lastly, an in-depth analysis of the genetic alterations in the tested microbes after treatment with CIP, SA and a combination of CIP and SA was carried out. The gene expression profile of lasB in P. aeruginosa , MrkA in K. pneumoniae and bsmB in S. marcescens were investigated using PCR. The combination of CIP and SA demonstrated 665 (a) (b) (c) Inhibition (%) 12.5 25 50 100 200 400 Minimum inhibitory concentration Dose concentration (µg/mL) 120 100 80 60 40 20 0 800 Inhibition (%) 15.625 31.25 62.5 125 250 500 Minimum inhibitory concentration Dose concentration (µg/mL) 120 100 80 60 40 20 0 1000 Inhibition (%) 15.625 31.25 62.5 125 250 500 Minimum inhibitory concentration Dose concentration (µg/mL) 120 100 80 60 40 20 0 1000

[Find the meaning and references behind the names: Rhl, Main, Target]

Int. J. Pharmacol., 20 (4): 660-671, 2024 Fig. 4(a-c): MBC of SA towards (a) P. aeruginosa , (b) K. pneumoniae and (c) S. marcescens in a dose-wise manner Fig. 5: Biofilm inhibition of P. aeruginosa Results are denoted as mean and SD and subjected to one way ANOVA (Tukey's Multiple Comparisons Test) which represented noticeable differences between control and treated groups (p<0.0001) notable downregulation of lasB, MrkA and bsmB in P. aeruginosa , K. pneumoniae and S. marcescens , respectively The P. aeruginosa has three main, intricately connected quorum sensing mechanisms: las, rhl and pqs 18 . The generation of virulence elements such as elastase, pyocyanin and biofilm development in P. aeruginosa has been reported to be effectively repressed by phenolic acid compounds, particularly SA 19,20 . At the same time, CIP could target the quorum sensing mechanism of P. aeruginosa hindering biofilm development 21 666 150 100 50 0 Biofilm inhibition (%) **** **** **** Control CIP (0.019 µg/mL) SA (100 µg/mL) CIP+SA (0.019+100 µg/mL) (a) (b) (c) (a) (b) (c) (a) (b) (c) Serratia marcescens : (a) 250 µg/mL, (b) 500 µg/mL (MIC) and (c) 1000 µg/mL (MBC), respectively Klebsiella pneumoniae : (a) 250 µg/mL, (b) 500 µg/mL (MIC) and (c) 1000 µg/mL (MBC), respectively Pseudomonas aeruginosa : (a) 200 µg/mL, (b) 400 µg/mL (MIC) and (c) 800 µg/mL (MBC), respectively

[Find the meaning and references behind the names: Standard, Mark, Bsma]

Int. J. Pharmacol., 20 (4): 660-671, 2024 Fig. 6: Biofilm inhibition of K. pneumoniae Results are denoted as mean and SD and subjected to one way ANOVA (Tukey's Multiple Comparisons Test) which expressed noticeable differences between control and treated groups (p<0.0001) Fig. 7: Biofilm inhibition of S. marcescens Outcomes were depicted as mean and SD and subjected to one way ANOVA (Tukey's Multiple Comparisons Test) which demonstrated noticeable differences between control and treated groups (p<0.0001) Fig. 8: Membrane stability of P. aeruginosa at different intervals Outcomes are denoted as mean and standard deviation and subjected to one way ANOVA (Tukeyʼs multiple comparisons test) which expressed noticeable differences between control and treated groups (p<0.0001) In the case of K. pneumoniae , MrkA protein one of the vital structural components of type 3 fimbriae which acts as appendages in the formation of biofilm had been negatively regulated after being subjected to CIP, SA and a combination of CIP and SA. The combination of CIP and SA downregulated the expression levels of MrkA, up to the mark that eventually impacted the organismʼs pathogenicity 19,20 . Quorum sensing regulatory genes namely bsmA and bsmB in S. marcescens were required for biofilm formation and also involved in adhesion to the abiotic 667 Control CIP (0.312 µg/mL) SA (125 µg/mL) CIP+SA (0.312+125 µg/mL) 150 100 50 0 Biofilm inhibition (%) **** **** **** 150 100 50 0 Biofilm inhibition (%) **** **** **** Control CIP (0.62 µg/mL) SA (125 µg/mL) CIP+SA (0.62+125 µg/mL) O D value at 565 nm 2 4 6 8 10 Time (min) Control CIP (0.019 µg/mL) SA (100 µg/mL) CIP+SA (0.019+100 µg/mL) 0.25 0.20 0.15 0.10 0.05 0.00 0

Int. J. Pharmacol., 20 (4): 660-671, 2024 Fig. 9: Membrane stability of K. pneumoniae at different intervals Findings are denoted as mean and standard deviation and subjected to one way ANOVA (Tukeyʼs multiple comparisons test) which expressed noticeable differences between control and treated groups (p<0.0001) Fig. 10: Membrane stability of S. marcescens at different intervals Outcomes are denoted as mean and standard deviation and subjected to one way ANOVA (Tukeyʼs multiple comparisons test) which expressed noticeable differences between control and treated groups (p<0.0001) Fig. 11: Time-kill kinetics of P. aeruginosa Findings are denoted as mean and standard deviation and subjected to one way ANOVA (Tukeyʼs multiple comparisons test) which expressed noticeable differences between control and treated groups (p<0.0001) 668 Control CIP (0.312 µg/mL) SA (125 µg/mL) CIP+SA (0.312+125 µg/mL) 2 4 6 8 10 Time (min) 0 O D value at 565 nm 0.3 0.2 0.1 0.0 O D value at 565 nm Control CIP (0.62 µg/mL) SA (125 µg/mL) CIP+SA (0.62+125 µg/mL) 2 4 6 8 10 Time (min) 0 0.25 0.20 0.15 0.10 0.05 0.00 O D value at 600 nm Control CIP (0.019 µg/mL) SA (100 µg/mL) CIP+SA (0.019+100 µg/mL) 4 8 12 Time (hrs) 0 1.5 1.0 0.5 0.0 24

[Find the meaning and references behind the names: Base]

Int. J. Pharmacol., 20 (4): 660-671, 2024 Fig. 12: Time-kill kinetics of K. pneumoniae Outcomes are represented as mean and standard deviation and subjected to one way ANOVA (Tukeyʼs multiple comparisons test) which expressed noticeable differences between control and treated groups (p<0.0001) Fig. 13: Time-kill kinetics of S. marcescens Findings are depicted as mean and standard deviation and subjected to one way ANOVA (Tukeyʼs multiple comparisons test) which indicated noticeable differences between control and treated groups (p<0.0001) Fig. 14: PCR products in agarose gel electrophoresis MrkA, bsmB and lasB were negatively regulated after treatment with the combination of CIP and SA than control, CIP and SA alone 669 O D value at 600 nm Control CIP (0.312 µg/mL) SA (125 µg/mL) CIP+SA (0.312+125 µg/mL) 4 8 12 Time (hrs) 0 1.5 1.0 0.5 0.0 24 O D value at 600 nm Control CIP (0.62 µg/mL) SA (125 µg/mL) CIP+SA (0.62+125 µg/mL) 4 8 12 Time (hrs) 0 1.5 1.0 0.5 0.0 24 Control Ciprofloxacin SA Ciprofloxacin+SA MrkA bsmB lasB 298 bp 249 bp 284 bp Base pair

[Find the meaning and references behind the names: Liu, Abdul, Lee, Ahmed, Xiong, Plant, Less, Sadiq, Act, Nowak, Yuan, Wang, Fang, Palaniappan, Dual, Single, Sci, Ullah, Chem, Gustafson, Melo, Ayaz, Borges, Alter, Future, Price, Rep, Yin, Zheng, Devkota, Zhou, Tao, Graham, Reason, Cui, Riordan, Ros, Lemos, Chen, Wilkinson, Rich, Holley]

Int. J. Pharmacol., 20 (4): 660-671, 2024 surfaces. The expression of bsmB was downregulated by the combination of CIP and SA which was consistent with other studies 21-23 . In a summarised form, phenolic acid compound, SA and CIP act synergistically and downregulated the virulence factors and quorum sensing regulatory genes in all the tested microbes The outcomes of the aforementioned assays and tests imply that SA in combination with CIP possesses greater antibacterial potential than SA alone. In a similar vein, even though CIP was broad spectrum antibiotic, its antibacterial potential was significantly increased when combined with SA. As it is generally known, phenolic compounds possess multifaceted antibacterial action. By causing the production of ROS, phenolic substances can cause endogenous oxidative stress in bacterial cells. Polyphenols have the potential to alter bacterial cell metabolism and protein production. It has been observed phenolic compounds inhibit ATP and DNA synthesis via inhibiting gyrase activity 24,25 . All these strategies could have been the reason for the antibacterial action of SA towards tested microbes. Conversely, CIP primarily acts by inhibiting the bacterial DNA gyrase enzyme. Briefly, CIP blocks bacterial topoisomerase II and DNA topoisomerase IV, as well as further stopping bacterial DNA from unwinding and duplicating, to impede DNA replication and transcription 5 . According to current study, at lower doses, the combined effects of CIP and SA unambiguously exhibited remarkable antibacterial efficacy against the tested microbes Finally, results demonstrated synergistic interaction for the combination of CIP and SA for P. aeruginosa , K. pneumoniae and S. marcescens . In closing, antibacterial capability against P. aeruginosa was more effective than compared to K. pneumoniae and S. marcescens . By decreasing the dosage of both drugs (CIP and SA), this combination at adequate dosage may be helpful in medical use and lessen the probability of an adverse impact on humans CONCLUSION To conclude, in the present investigation the antibacterial efficacy of SA was assessed alone and in combination with CIP against E. coli , S. aureus , P. aeruginosa , K. pneumoniae and S. marcescens but E. coli and S. aureus showed resistance to SA. The outcomes demonstrated the combination of CIP and SA exerts antibacterial potential at much lower concentrations against P. aeruginosa , K. pneumoniae and S. marcescens which could be beneficial for future use to minimize the detrimental effects on humans. To fully explore and comprehend the appropriate mode of action for the combination of CIP and SA, more research is required SIGNIFICANCE STATEMENT The present work explored the synergistic effect of salicylic acid and ciprofloxacin, against microbial strains Escherichia coli and S. aureus were resistant to SA. The combination of CIP and SA demonstrated less antibacterial activity against these bacteria, which might be useful for future application ACKNOWLEDGMENTS This paper and the research behind it would not have been possible without the support of the University of Jeddah and the exceptional help and support of my colleagues of our laboratory specialists and technicians REFERENCES 1 Xu, X., L. Xu, G. Yuan, Y. Wang, Y. Qu and M. Zhou, 2018. Synergistic combination of two antimicrobial agents closing each otherʼs mutant selection windows to prevent antimicrobial resistance. Sci. Rep., Vol. 8. 10.1038/s 41598-018-25714-z 2 Lemos, M., A. Borges, J. Teodósio, P. Araújo, F. Mergulhão, L. Melo and M. Simões, 2014. The effects of ferulic and salicylic acids on Bacillus cereus and Pseudomonas fluorescens single-and dual-species biofilms. Int. Biodeterior Biodegrad., 86: 42-51 3 Palaniappan, K. and R.A. Holley, 2010. Use of natural antimicrobials to increase antibiotic susceptibility of drug resistant bacteria. Int. J. Food Microbiol., 140: 164-168 4 Ayaz, M., F. Ullah, Abdul Sadiq, F. Ullah, M. Ovais, J. Ahmed and H.P. Devkota, 2019. Synergistic interactions of phytochemicals with antimicrobial agents: Potential strategy to counteract drug resistance. Chem. Biol. Interact., 308: 294-303 5 Fang, Y., J. Fu, C. Tao, P. Liu and B. Cui, 2020. Mechanical properties and antibacterial activities of novel starch-based composite films incorporated with salicylic acid. Int. J. Biol. Macromol., 155: 1350-1358 6 He, G., X. Chen, Y. Yin, H. Zheng, X. Xiong and Y. Du, 2011. Synthesis, characterization and antibacterial activity of salicyloyl chitosan. Carbohydr. Polym., 83: 1274-1278 7 Efenberger-Szmechtyk, M., A. Nowak and A. Czyzowska, 2021. Plant extracts rich in polyphenols: Antibacterial agents and natural preservatives for meat and meat products. Crit. Rev. Food Sci. Nutr., 61: 149-178 8 Price, C.T.D., I.R. Lee and J.E. Gustafson, 2000. The effects of salicylate on bacteria. Int. J. Biochem. Cell Biol., 32: 1029-1043 9 Riordan, J.T., A. Muthaiyan, W. van Voorhies, C.T. Price, J.E. Graham, B.J. Wilkinson and J.E. Gustafson, 2007. Response of Staphylococcus aureus to salicylate challenge. J. Bacteriol., 189: 220-227 670

[Find the meaning and references behind the names: De Souza, Zhang, Pharm, Mukherjee, Press, Cambridge, Song, Jia, Joice, Eds, Smyth, Gupta, Adamczak, Jiang, Joshi, Clin, Pawlowski, Soares, Willcox, Ski, Bandara, Dooley, Zini, Mortensen, Chu, Fernandes, Mateen, Nisha, Gunther, Front, Nag, Dey, Zhu, Smith, Luo, Yao, Allen, Souza, Clegg, Ray, Bark, Marchant, Ruan, Dutta, Med, Role, Oil, Woodhead, Murphy, Shilpa, Abdulhaq, Motta, Banat]

Int. J. Pharmacol., 20 (4): 660-671, 2024 10. Fernandes, P.B. and D.T.W. Chu, 1988. Quinolone Antibacterial Agents. In: Annual Reports in Medicinal Chemistry, Allen, R.C. (Ed.), Academic Press, Cambridge, Massachusetts, ISBN: 9780120405237, pp: 133-140 11. Tenover, F.C., 2006. Mechanisms of antimicrobial resistance in bacteria. Am. J. Med., 119: S 3-S 10 12. Fadwa, A.O., D.K. Alkoblan, A. Mateen and A.M. Albarag, 2021 Synergistic effects of zinc oxide nanoparticles and various antibiotics combination against Pseudomonas aeruginosa clinically isolated bacterial strains. Saudi J. Biol. Sci., 28: 928-935 13. de Oliveira Negreiros, M., Â. Pawlowski, C.A. Zini, G.L.G. Soares, A. de Souza Motta and A.P.G. Frazzon, 2016. Antimicrobial and antibiofilm activity of Baccharis psiadioides essential oil against antibiotic-resistant Enterococcus faecalis strains. Pharm. Biol., 54: 3272-3279 14. Reddy, L.S., M.M. Nisha, M. Joice and P.N. Shilpa, 2014 Antimicrobial activity of zinc oxide (ZnO) nanoparticle against Klebsiella pneumoniae . Pharm. Biol., 52: 1388-1397 15. Abdulhaq, A.A. and A.A. Hershan, 2023. In vitro antibacterial and in silico evaluation of Ficus benghalensis methanolic bark extract, as potential anti-MRSA agent. Indian J. Pharm. Educ. Res., 57: 466-477 16. Song, X., R. Li, Q. Zhang, S. He and Y. Wang, 2022 Antibacterial effect and possible mechanism of salicylic acid microcapsules against Escherichia coli and Staphylococcus aureus . Int. J. Environ. Res. Public Health, Vol. 19 10.3390/ijerph 191912761 17. Adamczak, A., M. O ó arowski and T.M. Karpi ½ ski, 2020 Antibacterial activity of some flavonoids and organic acids widely distributed in plants. J. Clin. Med., Vol. 9. 10.3390/jcm 9010109 18. Bandara, M.B.K., H. Zhu, P.R. Sankaridurg and M.D.P. Willcox, 2006. Salicylic acid reduces the production of several potential virulence factors of Pseudomonas aeruginosa associated with microbial keratitis. Invest. Ophthalmol. Vis. Sci., 47: 4453-4460 19. Lahiri, D., M. Nag, B. Dutta, S. Dey, D. Mukherjee, S.J. Joshi and R.R. Ray, 2021. Antibiofilm and anti quorum sensing activities of eugenol and linalool from Ocimum tenuiflorum against Pseudomonas aeruginosa biofilm. J. Appl. Microbiol., 131: 2821-2837 20. Ahmed, S.A.K.S., M. Rudden, T.J. Smyth, J.S.G. Dooley, R. Marchant and I.M. Banat, 2019. Natural quorum sensing inhibitors effectively downregulate gene expression of Pseudomonas aeruginosa virulence factors. Appl. Microbiol Biotechnol., 103: 3521-3535 21. Gupta, P., S. Chhibber and K. Harjai, 2016. Subinhibitory concentration of ciprofloxacin targets quorum sensing system of Pseudomonas aeruginosa causing inhibition of biofilm formation & reduction of virulence. Indian J. Med Res., 143: 643-651 22. Murphy, C.N., M.S. Mortensen, K.A. Krogfelt and S. Clegg, 2013. Role of Klebsiella pneumoniae type 1 and type 3 fimbriae in colonizing silicone tubes implanted into the bladders of mice as a model of catheter-associated urinary tract infections. Infect. Immun., 81: 3009-3017 23. Wang, L., Y. Zhang, Y. Liu, M. Xu and Z. Yao et al ., 2022. Effects of chlorogenic acid on antimicrobial, antivirulence, and anti-quorum sensing of carbapenem-resistant Klebsiella pneumoniae . Front. Microbiol., Vol. 13 10.3389/fmicb.2022.997310 24. Zhou, J.W., L.Y. Ruan, H.J. Chen, H.Z. Luo, H. Jiang, J.S. Wang and A.Q. Jia, 2019. Inhibition of quorum sensing and virulence in Serratia marcescens by hordenine. J. Agric. Food Chem., 67: 784-795 25. Smith, J., P.M. Fratamico and G. Uhlich, 2009. Molecular Mechanisms Involved in Biofilm Formation by Food- Associated Bacteria. In: Biofilms in the Food and Beverage Industries: Woodhead Publishing Series in Food Science, Technology and Nutrition, Fratamico, P.M., B.A. Annous and N.W. Gunther (Eds.), Woodhead Publishing, Sawston, Cambridge, ISBN: 9781845694777, pp: 42-98 671

Other Health Sciences Concepts:

[back to top]

Discover the significance of concepts within the article: ‘Synergistic Interaction of Salicylic Acid and Ciprofloxacin against...’. Further sources in the context of Health Sciences might help you critically compare this page with similair documents:

Ro, Phytochemical, Mode of action, Statistical analysis, Outer membrane, Oxidative stress, Minimum inhibitory concentration, Staphylococcus aureus, Escherichia coli, Pseudomonas aeruginosa, Synergistic effect, Gram positive bacteria, Gram negative bacteria, Minimum inhibitory concentration (MIC), Fractional inhibitory concentration index, Antimicrobial potential, Klebsiella pneumoniae, Bactericidal effect, Antibacterial efficacy, Synergistic interaction, Salicylic acid, Antibacterial potential, E. coli, Bacteriostatic effect, Minimum bactericidal concentration, S. aureus, P. aeruginosa, Biofilm formation, ISBN, Ciprofloxacin, Synergy, Molecular mechanism, Serratia marcescens, UV-Vis spectrophotometer, Microbial strains, PCR, Bacterial virulence, Minimal Bactericidal Concentration (MBC), Quorum sensing, Antimicrobial drug resistance, Phenolic compound, Bacterial DNA, MIC, MBC, Bacterial population, DNA replication, CELL WALL, Virulence factor, K. pneumoniae, Adhesion, Crystal violet assay, Elastase, Topoisomerase II, Phytoconstituent, Bacterial cell membrane, Minimal bactericidal concentration, Bacterial growth inhibition, Food science, Detrimental effect, DNA synthesis, DNA gyrase, Gene expression studies, Cellular content, Topoisomerase IV, Biofilm development, Phenolic acid compounds, Biofilm Eradication, ROS production, Virulence Gene Expression, ATP synthesis, CrossRef, FICI, Protein production, Minimum bactericidal, Direct Link, Membrane stability, Time-kill kinetics, Woodhead Publishing, Transcription, Bacterial DNA gyrase, Antimicrobial capability, MHB, S. marcescens, Food and Beverage Industries.