International Journal of Pharmacology

2005 | 9,241,751 words

The International Journal of Pharmacology (IJP) is a globally peer-reviewed open access journal covering the full spectrum of drug and medicine interactions with biological systems, including chemical, physiological, and behavioral effects across areas such as cardiovascular, neuro-, immuno-, and cellular pharmacology. It features research on drug ...

Effects of Picroside Regulating the lncRNA-MALAT1/miR-21/PPAR Signaling...

Author(s):

Dan Liu
Department of Obstetrics and Gynecology, Changsha No. 4 Hospital, Changsha 410006, Hunan, China
Yang Zhang
Department of Obstetrics and Gynecology, Changsha No. 4 Hospital, Changsha 410006, Hunan, China
Guxiang Zhang
Department of Obstetrics and Gynecology, Changsha No. 4 Hospital, Changsha 410006, Hunan, China
Chengfang Xie
Department of Obstetrics and Gynecology, Changsha No. 4 Hospital, Changsha 410006, Hunan, China


Read the Summary


Year: 2024 | Doi: 10.3923/ijp.2024.1063.1075

Copyright (license): Creative Commons Attribution 4.0 International (CC BY 4.0) license.


[Full title: Effects of Picroside Regulating the lncRNA-MALAT1/miR-21/PPAR Signaling Pathway in Fat Synthesis of Patients with Gestational Diabetes Mellitus]

[[[ p. 1 ]]]

[[[ p. 2 ]]]

[Summary: This page introduces a study on picroside's effects on fat synthesis in gestational diabetes mellitus (GDM) patients. It explores how picroside regulates the lncRNA-MALAT1/miR-21/PPAR-γ signaling pathway. The study involves extracting and purifying picroside, using human adipocytes, and measuring triglyceride, cholesterol, lncRNA-MALAT1, miR-21, and protein levels.]

OPEN ACCESS International Journal of Pharmacology ISSN 1811-7775 DOI: 10.3923/ijp.2024.1063.1075 Research Article Effects of Picroside Regulating the lncRNA-MALAT 1/miR-21/PPAR Signaling Pathway in Fat Synthesis of Patients with Gestational Diabetes Mellitus Dan Liu, Yang Zhang, Guxiang Zhang and Chengfang Xie Department of Obstetrics and Gynecology, Changsha No. 4 Hospital, Changsha 410006, Hunan, China Abstract Background and Objective: The regulatory mechanism of picroside on fat synthesis in Gestational Diabetes Mellitus (GDM) remains unclear at present. This work investigated the regulatory effect of picroside on fat synthesis in patients with GDM and analyzed the roles of picroside in regulating the lncRNA-MALAT 1, miR-21 and PPAR- γ signaling pathways (SPWs) in its effects on fat synthesis Materials and Methods: Picroside was extracted and purified. Human subcutaneous adipocytes (3 T 3-L 1) were divided into control (Ctrl), model (Mod) and picroside groups. Triglyceride (TG) and total cholesterol (TC) were detected and lncRNA-MALAT 1 and miR-21 were measured. Protein levels of Peroxisome Proliferator-Activated Receptor Gamma (PPAR- γ ), CCAAT/Enhancer-Binding Protein Alpha (C/EBP- " ), etc., were determined. Results: The highest concentration of picroside extracted after 3 hrs using 95% ethanol was 279.25 mg/g. After purification with D 201 macroporous adsorption resin, the mass fraction of picroside was 43.23%. In the Mod group, levels of TC, TG and lncRNA-MALAT 1 were markedly elevated versus the Ctrl group (p<0.05). In picroside group, TC, TG and lncRNA-MALAT 1 levels were superior to the Mod group (p<0.05). Conclusion: These findings indicated that picroside regulated fat synthesis in patients with GDM through the lncRNA-MALAT 1/miR-21/PPAR- γ SPW Key words: Picroside, gestational diabetes mellitus, ncRNA-MALAT 1, PPAR signaling pathway, fat synthesis Citation: Liu, D., Y. Zhang, G. Zhang and C. Xie, 2024. Effects of picroside regulating the lncRNA-MALAT 1/miR-21/PPAR signaling pathway in fat synthesis of patients with gestational diabetes mellitus. Int. J. Pharmacol., 20: 1063-1075 Corresponding Author: Dan Liu, Department of Obstetrics and Gynecology, Changsha No. 4 Hospital, Changsha 410006, Hunan, China Copyright: © 2024 Dan Liu et al. This is an open access article distributed under the terms of the creative commons attribution License, which permits unrestricted use, distribution and reproduction in any medium, provided the original author and source are credited Competing Interest: The authors have declared that no competing interest exists Data Availability: All relevant data are within the paper and its supporting information files.

[[[ p. 3 ]]]

[Summary: This page discusses GDM as a common pregnancy complication with limitations in current treatments. It highlights the role of aberrant fat synthesis and insulin resistance in GDM, mentioning lncRNA-MALAT1 and miR-21's involvement. It introduces picroside from Coptis chinensis as a potential treatment, noting its anti-inflammatory and blood glucose-lowering properties. The study aims to explore picroside's effects on fat synthesis in GDM.]

Int. J. Pharmacol., 20 (6): 1063-1075, 2024 INTRODUCTION Gestational Diabetes Mellitus (GDM) is a transient hyperglycemia in the period of pregnancy and is among the most common pregnancy complications 1-3 . The GDM not only increases the risk of maternal conditions such as gestational hypertension and diabetes but also raises the risk of fetal malformations and neonatal hypoglycemia 4 . Currently, employed clinical interventions for GDM, including dietary control, physical exercise and insulin injections, face various limitations during implementation 5 . Aberrant fat synthesis is a crucial factor in the progression of GDM and is regulated by multiple molecular mechanisms, closely associated with insulin signaling pathways 6 . Chronic insulin resistance and abnormal insulin secretion are key features of GDM, although the precise regulatory mechanisms remain unclear 7 . The IncRNA-MALAT 1 may be crucial in insulin signaling and glucose metabolism 8 . Additionally, MicroRNA-21(miR-21) is tightly linked to insulin secretion and insulin resistance 9 Coptis chinensis , commonly known as Huang-Lian, is an extensively utilized medicinal herb in traditional Chinese medicine. It is known for its properties of clearing dampness, cooling blood, drying dampness and relieving infantile malnutrition. It is used to treat conditions such as bone-steaming fever, jaundice, cold and heat diarrhea, infantile malnutrition, spontaneous sweating, night sweats, hemorrhoids and abscesses 10,11 . Picroside is one of the active components extracted from the traditional herb Coptis chinensis . It exhibits significant anti-inflammatory effects, inhibiting the release of inflammatory mediators and the occurrence of inflammatory reactions. This potential therapeutic use has been explored for inflammation-related conditions such as intestinal inflammation and arthritis 12,13 Research has indicated that picroside can inhibit tumor cell growth, induce apoptosis and inhibit metastasis. It also enhances the sensitivity to chemotherapy drugs, showing inhibitory effects on cancers like liver, breast and lung cancer 14 . Picroside has demonstrated blood glucose-lowering activity by increasing insulin sensitivity and promoting glucose utilization. It has been extensively studied and applied in treating GDM 15 . Picroside can improve insulin resistance, enhance insulin secretion and improve insulin signal transmission efficiency 16 . By inhibiting hepatic glycogen synthesis and increasing the expression of glucose transporter proteins in the liver, picroside can lower blood glucose levels 17 Research results have indicated that picroside can also reduce lipid synthesis in fat cells and mitigate adipose tissue inflammation, thereby improving insulin resistance and metabolic abnormalities 18 However, the regulatory mechanism of picroside on fat synthesis in GDM remains unclear. In this context, this work was developed focusing on the regulatory effect of picroside on fat synthesis in patients with GDM and further, exploring its potential molecular mechanisms. It was hypothesized that picroside may regulate the fat synthesis of patients with GDM through the lncRNA-MALAT 1/miR-21/PPAR- γ signaling pathway (SPW). Meanwhile, this work focused on elucidating the role of picroside in modulating lncRNA-MALAT 1, miR-21 and PPAR- γ SPW, to understand the effects of picroside on fat synthesis. Ultimately, this work was to yield new insights and potential targets in preventing and treating GDM MATERIALS AND METHODS Study area: The study was conducted at the Changsha No. 4 Hospital from October, 2022 to July, 2023 Methods for picroside crude extraction: The methodology outlined in Qin et al 19 utilized the immersion method and organic solvent extraction to crudely extract picroside from the roots and rhizomes of Coptis chinensis (Anhui Bozhou Medicinal Market, China). The specific procedure was as follows. As 600 g of Coptis chinensis rhizomes were pulverized and coarse particles were removed by sieving through a 10-30 mesh screen. The sieved Coptis chinensis rhizomes were soaked in industrial alcohol for one week. The soaking solution was filtered and the collected filtrate was combined. The collected soaking solution was subjected to vacuum distillation using a rotary evaporator to recover ethanol. By controlling temperature and pressure, ethanol was evaporated to obtain concentrated Coptis chinensis total extract, which was then suspended in water to ensure thorough mixing. Subsequently, successive extractions were performed to obtain the petroleum ether fraction (1#), chloroform fraction (2#), ethyl acetate fraction (3#), n-butanol fraction (4#) and water-soluble fraction (5#) of the active components. The crude extraction process of picroside was illustrated in Fig. 1 Methods for picroside extraction: Following the methodology described in Wang et al 20 , the Soxhlet extraction method was employed to further extract picroside from the crude extract. Six grams of picroside crude extract (PCE) was mixed with 3 to 9 times its weight of ethanol solution, with ethanol concentrations ranging from 55 to 95%. The extraction was carried out for 1 to 4 hrs, with 2 to 5 extraction cycles, until the solvent became colorless 1064

[[[ p. 4 ]]]

[Summary: This page details the methods for picroside crude extraction and purification using MPAR, including pretreatment and HPLC analysis for picroside detection. Equations for calculating resin adsorption capacity and desorption rate are provided. The page also outlines the culture, induction, differentiation, and grouping of 3T3-L1 cells into control, model, and picroside groups.]

Int. J. Pharmacol., 20 (6): 1063-1075, 2024 Fig. 1: Visualized presentation of picroside crude process MPAR to purify picroside: The D 101 macroporous resin (TianjiOuri BioTech Co., Ltd., China), NKA-9 macroporous adsorption resin (Tianjin Nankai University Chemical Plant, China), DB 301 macroporous adsorption resin (Tianjin Ouri BioTech Co., Ltd., China), D 3520, D 201 and AB-8 macroporous adsorption resin (Tianjin University Chemical Plant, China), HPD 100 macroporous adsorption resin (Cangzhou Baon Chemical Co., Ltd., China) underwent pretreatment. Then, 0.4 g of pretreated MPAR was weighed into a 50 mL conical flask, which was filled with 30 mL of Coptis chinensis extract The samples were thoroughly adsorbed using an electric shaker at a frequency of 140 oscillations per minute for a continuous duration of 10 hrs. Subsequently, the mixture was filtered. The remaining concentration of picroside in the filtrate was determined using High-Performance Liquid Chromatography (HPLC) system (1260 Infinity model, Agilent Technologies, USA). The adsorption capacity of each resin at room temperature was calculated using the following Eq. 1: (1) 1 2 C C C A W   where, A c represented the resin adsorption capacity, in mg/g, C 1 was the initial concentration, in mg/mL and C 2 was the remaining concentration, in mg/mL, v represented the solution volume, in mL and W stood for the resin weight, in g After achieving full adsorption, 30 mL of ethanol solutions with concentrations of 55, 65, 75, 85 and 95% were individually added to the resin. The mixtures were subjected to 10 hrs of oscillation, followed by filtration. The remaining concentration of picroside in the filtrate was determined using HPLC. The desorption rate of picroside from the macroporous resin was calculated using the following Eq. 2 21 : (2) C r C D D A  where, A c represented the resin adsorption capacity, in mg/g, D r stood for the resin desorption rate, in percentage (%) and D c referred to desorption, in mg/g Picroside detection: Ten milligrams of reference standard of picroside (China National Institutes for Food and Drug Control, China) and 5 mg of test samples were individually weighed and dissolved in water, then diluted to the respective concentrations. The HPLC was employed to quantify the amount of picroside in the extracts and purified products. Chromatographic column (Agilent Technologies, USA; Plus C 18) with dimensions of 4.6×250 mm and a particle size (PS) of 5 µm was used. The mobile phase for the chromatographic column was a mixture of acetonitrile and water (in a volume ratio of 19:81). Detection was carried out at 264 nm. The injection volume was 10 µL and the flow rate was set at 1 mL/min, with the column temperature maintained at 30 E C Culture, induction differentiation and grouping of 3 T 3-L 1 cells: Human subcutaneous adipocytes (3 T 3-L 1) were seeded onto a 6-well plate and cultured in Dulbeccoʼs Modified Eagle Medium (DMEM) (Gibco, USA) complete medium containing 0.1% fetal bovine serum, 10 U/L penicillin and 10 U/L streptomycin. The 3 T 3-L 1 cells from the 4 th to 6 th passages were used for induction and differentiation. Upon cell confluence, the medium was switched to DMEM complete medium containing 0.5 mmol/L isobutylmethylxanthine 1065 Smash Sieving Alcohol soak Collecting filtrate Distil Extract of Coptis chinensis 1# 2# 3# 4# 5# Rhizome of Coptis chinensis

[[[ p. 5 ]]]

[Summary: This page describes the detection of fat synthesis indicators (TG and TC) in 3T3-L1 cells using assay kits and a microplate reader. It outlines the RT-qPCR method for assessing lncRNA-MALAT1 and miR-21 expression, including RNA extraction, reverse transcription, and primer sequences. The page also details Western blotting procedures for measuring protein levels of PPAR-γ, C/EBP-α, FAS, and ACC.]

Int. J. Pharmacol., 20 (6): 1063-1075, 2024 (IBMX), 0.25 µmol/L dexamethasone and 1 mg/L insulin for induction and differentiation of 3 T 3-L 1 cells. After 48 hrs of cultivation, the medium was continued with DMEM complete medium containing only 1 mg/L insulin and the cells were further cultured for approximately 13 days until over 90% of the cells had differentiated into mature adipocytes Based on different cell treatments, the cells were categorized into three groups: Control (Ctrl) group, model (Mod) group and picroside group. In Ctrl group, cells were treated with DMEM medium. In Mod group, cells were subjected to induction and differentiation treatment. In the picroside group, cells were induced and differentiated and then treated with 100 µL of purified picroside to achieve concentrations of 0.16, 0.48 and 1.44 mg/mL, respectively. Each group was composed of 6 replicates Detection of indicators related to fat synthesis: Triglyceride (TG) and total cholesterol (TC) contents in the 3 T 3-L 1 cells were quantified using triglyceride and total cholesterol assay kit (Beijing ApplyGen Company, China). After adjusting the concentration to 6×10 5 cells/mL, they were seeded into a 6-well culture plate until they reached 80% confluence. After reaching this confluence, cells were treated according to the different group protocols. The culture medium was removed after a 24 hrs treatment period and cells were washed twice with pre-chilled PBS. Cells were then collected by centrifugation at 1,300 rpm for 15 min. The cell pellet was treated with TG cell lysis solution for 30 min and 10 µL of the lysate was transferred to a detection plate. Subsequently, 190 µL of a working solution was added and the plate was incubated at 37 E C in the dark for 20 min. Absorbance at 570 nm was measured using a SpectraMax iD 3 microplate reader (Zhejiang Meigu Biotechnology Co., Ltd., China) and TG and TC contents were calculated based on the absorbance values RT-qPCR method to detect expressions of cell factors: Expressions of lncRNA-MALAT 1 and miR-21 in distinct groups of 3 T 3-L 1 cells were assessed using the RT-qPCR method. Cells treated under different conditions were collected and treated with 1 mL of TRIzol reagent for cell lysis. Total RNA was extracted from the human 3 T 3-L 1 cells using the TRIzol method. After assessing the extracted total RNA using agarose gel electrophoresis, reverse transcription was performed using a reverse transcription kit (Nanjing Shengxing Biotechnology Co., Ltd., China) with the following protocol: 37 E C for 15 min, followed by 85 E C for 5 sec. The GAPDH and U 6 were used as internal references for lncRNA-MALAT 1 and miR-21, respectively, to analyze their expression levels in the cells. Each reaction was performed in triplicate, with an annealing temperature of 60 E C and an annealing time of 30 sec for 30 cycles. Furthermore, the 2 G )) ct method was utilized to calculate the levels of lncRNA-MALAT 1 and miR-21 in the cells. The primer sequences for lncRNA-MALAT 1, miR-21, GAPDH and U 6 amplification were provided in Table 1 Western blotting: Protein levels of PPAR- γ , C/EBP- " , FAS and ACC in the cells were determined using the western blotting method. Total proteins were extracted from the cells using RIPA solution. The protein concentration was quantified using the Bicinchoninic Acid kit (Shanghai Beyotime Biotechnology Co., Ltd., China). Proteins were separated using SDS-PAGE electrophoresis and transferred to a PVDF membrane. The membrane was blocked with 5% skim milk at room temperature for 2 hrs. Subsequently, diluted primary antibodies, including PPAR- γ (1:2000), C/EBP- " (1:2000), FAS (1:2000), ACC (1:2000) and $ -actin (1:1000), were added and incubated overnight at 4 E C. The primary antibody against the protein was purchased from Abcam (UK). The membrane was washed with TBST, followed by incubation with Horseradish Peroxidase-conjugated IgG secondary antibodies (1:8000) at room temperature for 1 hr. The secondary antibody against the protein was purchased from Signalway Antibody, USA. After washing the membrane with TBST, chemiluminescence assay kit (Shanghai Beyotime Biotechnology Co., Ltd., China) were used to visualize protein bands. The intensity of the target protein bands was quantified using ImageJ in a KETA GL fully automated gel imaging analysis system (Wealtec Corporation, USA) Statistical analysis: All experimental data were presented as Mean±Standard Deviation or frequency (%) and analyzed using SPSS 22.0. For continuous variables, a t-test was employed for comparisons between two groups and One-way Analysis of Variance (ANOVA) was utilized for comparisons among multiple groups. The Chi-square test was adopted for categorical data. The p<0.05 was considered statistically significant Table 1: Primers sequences Gene Forward primer Reverse primer lncRNA-MALAT 1 5'-TGGATTTCGTGGCCCCAGTGCTA-3' 5'-GCCACTGCTGTAGCCACTCA-3' miR-21 5'- TTCATCCTGTTCTTCCTCGGCG -3' 5'- AGGTTACCAACAGAGTGTCTTG-3' GAPDH 5'-AGTTCAACGGCACAGTCAAG-3' 5'-CAGCCTTCTCCATGGTGGTG-3' U 6 5'- GAGAGAAGCCGTCGTGT-3' 5'- TTGC-GAAGTGCTTAAACGCA-3' 1066

[[[ p. 6 ]]]

[Summary: This page presents the results of picroside content analysis in different particle sizes (PS) of Coptis chinensis root, showing that picroside content increased with PS. It also shows extraction yields of picroside in different solvents, with n-butanol yielding the highest extraction yield. The page shows that n-butanol is suitable for picroside extraction.]

Int. J. Pharmacol., 20 (6): 1063-1075, 2024 RESULTS Results of PCE: Firstly, the analysis of picroside content in different PSs of Coptis chinensis root was conducted, as presented in Fig. 2. As the PS increased, the content of picroside gradually increased. The picroside content was 6.76% for PSs of 10~15 mesh and it increased to 13.23% when the PS was in the range of 25~30 mesh It can be observed that the best picroside extraction efficiency was achieved with a PS of 25~30 mesh. Hence, for subsequent experiments, PSs of 20~25 mesh were selected, corresponding to a picroside content of 11.62% With the yield of Coptis chinensis root as the reference (100%), the extraction yields of picroside in different solvents were calculated and the statistical results of different product weights and their corresponding picroside extraction yields were presented in Fig. 3. The total weight of Coptis chinensis crude extract was 224 g, corresponding to a picroside extraction yield of 37.33%. Among the various extraction solvents, the highest extraction yield was obtained with the n-butanol fraction (4#), reaching up to 17.67%. Based on these findings, we can infer that n-butanol is one of the most suitable solvents for the crude extraction of picroside. It can effectively extract picroside from the plant material and achieve a relatively high picroside extraction yield Fig. 2: Influences of PS on picroside content Fig. 3: Extraction results of picroside 1067 10~15 15 12 9 6 3 0 Content (%) 15~20 20~25 25~30 Granularity (mesh) Rhizoma coptidis 600 500 400 300 200 100 0 W eight (g) 100 80 60 40 20 0 Y ield (%) Extract 1# 2# 3# 4# 5# Weight Yield

[[[ p. 7 ]]]

[Summary: This page presents results on factors influencing picroside extraction. Increased solvent volume and ethanol concentration enhanced extraction, while longer extraction times and more cycles boosted yield, with a saturation effect. The page also details the purification of picroside using MPAR, with D201 MPAR showing the highest performance. Desorption rates of various MPARs at different ethanol concentrations are also shown.]

Int. J. Pharmacol., 20 (6): 1063-1075, 2024 Fig. 4(a-d): Influencing factors of picroside extraction, (a) Solvent volume, (b) Ethanol concentration, (c) Extraction time and (d) Number of extractions Influencing factors of picroside extraction: Figure 4 illustrated the effects of solvent volume, ethanol concentration, extraction time and number of extractions on the extraction of picroside. As both solvent volume and ethanol concentration increased, the extraction of picroside showed a noticeable upward trend. When the solvent volume was 9 times the sample weight, the highest picroside extraction was recorded at 294.52 mg/g (Fig. 4 a). Similarly, with an ethanol concentration of 95%, the maximum picroside extraction reached 363.83 mg/g (Fig. 4 b). Additionally, it was evident that the extraction of picroside initially increased and then stabilized with longer extraction times and higher numbers of extractions. At a 3 hrs extraction time, the picroside yield was 251.19 mg/g (Fig. 4 c) and with 3 extraction cycles, the yield reached 279.25 mg/g (Fig. 4 d). Further increasing the number of extractions did not greatly affect the picroside yield. These results indicated that increasing solvent volume and ethanol concentration enhanced the picroside extraction efficiency, while extending extraction time and conducting more extractions boost picroside yield, albeit with a saturation effect. Therefore, solvent volume at 9 times the sample weight, 95% ethanol concentration, 3 hrs extraction time and 3 hrs extraction cycles for picroside extraction were defined and employed in this work Results of picroside purification: The ability of different types of MPAR to purify picroside was evaluated from three aspects: Picroside mass fraction, picroside yield and picroside adsorption capacity. The statistical results were presented in Fig. 5. Variations in picroside mass fraction, yield and adsorption capacity were observed among different types of MPARs. Among them, D 201 MPAR exhibited the highest performance in purifying picroside, followed by AB-8 MPAR (Fig. 5 a-c). For D 201 MPAR, the picroside mass fraction, yield and adsorption capacity were 43.23%, 20.30 g and 222.28 mg/g, respectively. For AB-8 MPAR, the corresponding values were 39.92%, 18.26 g and 210.49 mg/g, respectively Figure 6 illustrated the desorption rates of various types of MPARs at distinct ethanol concentrations. It was evident from the graph that both D 201 and AB-8 MPARs exhibited higher desorption rates compared to other MPARs. Among them, D 201 MPAR demonstrated the highest picroside desorption rate under different ethanol concentrations. With increasing ethanol concentration, the picroside desorption rate of D 201 MPAR initially elevated and then declined. Specifically, when the ethanol was 55, 65, 75, 85 and 95%, the picroside desorption rates of D 201 MPAR were 82.46, 98.25, 100.29, 99.18 and 97.39%, respectively 1068 300 200 100 0 Content (mg/g) (a) 3 5 7 9 Reagent dosage (time) 400 300 200 100 0 Content (mg/g) (b) 55 65 75 85 Concentration (%) 95 300 200 100 0 Content (mg/g) (c) 1 2 3 4 Time (hrs) 300 200 100 0 Content (mg/g) (d) 2 3 4 5 Frequency (time)

[[[ p. 8 ]]]

Int. J. Pharmacol., 20 (6): 1063-1075, 2024 Fig. 5(a-c): Effects of different MPARs on picroside adsorption capacity, (a) Mass fraction, (b) Yield and (c) Adsorption capacity Fig. 6: Effects of MPARs on picroside desorption rate Influences of picroside on TC and TG contents: Figure 7 illustrated the TC and TG levels in 3 T 3-L 1 cells from different groups. In the Mod group, the TC content was elevated compared to the Ctrl group (p<0.001). The TC content in 3 T 3-L 1 cells treated with 0.16 mg/mL picroside was higher than that in the Ctrl group (p<0.01), but lower than that in the Mod group (p<0.05). After treatment with 0.48 mg/mL picroside, the TC content in 3 T 3-L 1 cells was higher than that in the Ctrl group (p<0.05), but significantly lower than that in the Mod group (p<0.01). In 3 T 3-L 1 cells treated with 1069 40 30 20 10 0 Mass fraction (%) (a) D 101 NKA -9 D B 301 D 3520 D 201 AB -8 HPD 10 0 20 15 10 5 0 W eight (g) (b) D 101 NKA -9 D B 301 D 3520 D 201 AB -8 H PD 100 40 30 20 10 0 Mass fraction (%) (c) D 101 NKA -9 D B 301 D 3520 D 201 AB -8 HPD 10 0 55 120 90 60 30 0 Desorption rate (%) 65 75 85 Ethanol concentration (%) D 101 NKA-9 DB 301 D 3520 D 201 AB-8 HPD 100 95

[[[ p. 9 ]]]

Int. J. Pharmacol., 20 (6): 1063-1075, 2024 Fig. 7(a-b): Effects of picroside on (a) TC and (b) TG contents # Compared with Ctrl group (p<0.05), ## Compared with Ctrl group (p<0.01), ### Compared with Ctrl group (p<0.001), *Compared with Mod group (p<0.05) and **Compared with Mod group (p<0.01) Fig. 8(a-b): Effects of picroside on (a) lncRNA-MALAT 1 and (b) miR-21 # Compared with Ctrl group (p<0.05), ## Compared with Ctrl group (p<0.01), ### Compared with Ctrl group (p<0.001), *Compared with Mod group (p<0.05) and **Compared with Mod group (p<0.01) 1.44 mg/mL picroside, the TC content was lower than that in the Mod group (p<0.01) (Fig. 7 a). Similarly, in the Mod group, the TG content was elevated compared to the Ctrl group (p<0.001). The TG content in 3 T 3-L 1 cells treated with 0.16 mg/mL picroside was higher than that in the Ctrl group (p<0.01), but lower than that in the Mod group (p<0.05) After treatment with 0.48 mg/mL picroside, the TG content in 3 T 3-L 1 cells was higher than that in the Ctrl group (p<0.05), but significantly lower than that in the Mod group (p<0.01) In 3 T 3-L 1 cells treated with 1.44 mg/mL picroside, the TG content was lower than that in the Mod group (p<0.01) (Fig. 7 b) Effects of picroside on lncRNA-MALAT 1 and miR-21: Figure 8 a compared the lncRNA-MALAT 1 in different 3 T 3-L 1 cells groups. The Mod group exhibited sharply higher lncRNA-MALAT 1 compared to Ctrl group. Treatment with picroside lead to a remarkable downregulation in lncRNA-MALAT 1 based on that in Mod group (p<0.05), but it remained higher when comparing to Ctrl group (p<0.05) Figure 8 b compared the changes in miR-21 in 3 T 3-L 1 cells from different groups. The Mod group showed decreased miR-21 and exhibited great difference with Ctrl group (p<0.05). Treatment with picroside leads to a remarkable increase in miR-21 expression and showed a visible difference to Mod group (p<0.05), while it remained lower when comparing with the Ctrl group (p<0.05) Effects of picroside on protein levels of PPAR- γ SPW: The effects of picroside on PPAR- γ , C/EBP- " , FAS and ACC, as well as SPW, were presented in Fig. 9. In the Mod group, PPAR- γ decreased to Ctrl and picroside groups, showing obvious differences with p<0.001 and p<0.05, respectively. Protein levels of C/EBP- " , FAS and ACC in Mod group were all sharply lower and exhibited obvious differences with those in Ctrl group (p<0.05) (Fig. 9 a-e) and those in picroside group showed an increase with observable differences to the levels in Mod group (p<0.05) 1070 400 300 200 100 0 T C (µmol/mg) (a) Control Model 0.16 0.48 1.44 ### ##* #** ** 400 300 200 100 0 T G (µmol/mg) (b) Control Model 0.16 0.48 1.44 ### ##* #** ** 4 3 2 1 0 Inc R N A -M A L A T 1 (a) Control Model 0.16 0.48 1.44 ### ##* #** ** 4 3 2 1 0 miR-21 (b) Control Model 0.16 0.48 1.44 ### ## ##* #*

[[[ p. 10 ]]]

Int. J. Pharmacol., 20 (6): 1063-1075, 2024 Fig. 9(a-e): Effects of picroside on protein levels of (a) PPAR- γ SPW, (b) PPAR- γ , (c) C/EBP- " , (d) FAS and (e) ACC western blotting results # Compared with Ctrl group (p<0.05), ### Compared with Ctrl group (p<0.001) and *Compared with Mod group (p<0.05) DISCUSSION This study investigated the variation in picroside content under different particle sizes of Coptis chinensis roots and rhizomes granules. It was observed that with a decrease in particle size, the extraction yield of picroside increased, indicating better extraction efficiency. This phenomenon may be attributed to the larger surface area of smaller particles, which enhances the effective extraction region, thereby facilitating greater solvent contact, promoting the dissolution and release of picroside. Smaller particles have enhanced contact with the solvent, leading to increased transfer rates and extraction efficiency of the extract. However, using finer particles for reflux extraction may lead to overly concentrated solutions and a higher risk of boiling over 22 , thereby increasing the experimental risk. Subsequently, this study evaluated the 1071 1.2 0.9 0.6 0.3 0.0 FA S (a) Control Model Hubritin # * 1.2 0.9 0.6 0.3 0.0 C/ E B P - a (b) Control Model Hubritin # * 1.2 0.9 0.6 0.3 0.0 PA PA R - g (c) Control Model Hubritin ### * 1.2 0.9 0.6 0.3 0.0 ACC (d) Control Model Hubritin # * (e) Control Model Hubritin PPAR-γ C/EBP-α FAS ACC β-actin

[[[ p. 11 ]]]

[Summary: This page discusses the differing purification effectiveness of picroside using various resin types due to chemical properties and pore structures. It confirms the performance ranking of macroporous resins and discusses the high resolution rate of picroside by D201 macroporous resin. It also notes that GDM is characterized by abnormal glucose metabolism in the maternal body during pregnancy.]

Int. J. Pharmacol., 20 (6): 1063-1075, 2024 differences in the purification effectiveness of picroside using various resin types. Different resin types possess distinct chemical properties and pore structures 23 , which may contribute to variations in their adsorption capacities for picroside. The results of this study confirm the performance ranking of macroporous adsorption resins in purifying picroside as follows: D 201>AB-8>D 101>NKA-9>D 3520> DB 301>HPD 100. Additionally, irrespective of the concentration of ethanol treatment, the resolution rate of picroside by D 201 macroporous adsorption resin consistently remained above 80%. The D 201 MPAR likely possesses surface characteristics and pore structures that are more suitable for interacting with picroside, leading to enhanced adsorption capacity. On the other hand, HPD 100 MPAR might have inferior compatibility, resulting in lower adsorption efficiency 24 . As a results, D 201 MPAR exhibited the highest picroside desorption rate, likely due to its strong interaction with picroside molecules, making them more easily released during the desorption process. As ethanol concentration increased, the picroside desorption rate of D 201 MPAR showed an initial increase followed by a decrease. This phenomenon could be attributed to the fact that low concentrations of ethanol disrupt the interaction between picroside and the resin, facilitating the desorption process. However, with further increase in ethanol concentration, solvent effects or changes in the reactivity of picroside molecules 25,26 might lead to a decrease in the desorption rate 27 The GDM is characterized by abnormal glucose metabolism in the maternal body during pregnancy, representing one of the initial occurrences of diabetes and a common complication during pregnancy. Throughout gestation, hormones produced by the placenta and pregnancy-associated hormones induce elevated levels of cholesterol and triglycerides to meet the demands of fetal growth and development 27 . However, in some pregnant women, insufficient insulin secretion or increased insulin resistance can result in elevated blood glucose levels, leading to the onset of gestational diabetes. For women with gestational diabetes, the levels of TC and TG may be slightly higher compared to pregnant women without gestational diabetes 28,29 , owing to increased release of fatty acids due to insulin resistance, thereby stimulating the synthesis of cholesterol and triglycerides in the liver 30 . This study discovered that induction of 3 T 3-L 1 cells using DMEM medium containing IBMX, dexamethasone and insulin to prepare a GDM cell model resulted in significantly elevated levels of TC and TG. This indicates abnormal synthesis and accumulation of cholesterol and triglycerides in the cells of the model group, possibly associated with insulin resistance, abnormal glucose metabolism and dysregulation of fatty acid metabolism. These findings aligned with the observed lipid metabolism disorders in other studies on GDM models 31 . Picroside, as a natural herbal component, has been extensively studied for its regulatory effects on lipid metabolism. The present study found that treatment with picroside at different concentrations significantly reduced TC and TG levels in the 3 T 3-L 1 cell model, exhibiting concentration-dependent characteristics. This suggests that picroside may have the potential to regulate fat metabolism The LncRNA-MALAT 1 is implicated in numerous biological processes and the development of diseases. Its association with GDM occurrence and related pathophysiological mechanisms has been reported by Cremer et al 32 . One study revealed that upregulation of lncRNA-MALAT 1 may be associated with adipocyte differentiation and fatty acid synthesis 33 . This suggests a potential role for lncRNA-MALAT 1 in regulating fat synthesis processes. Furthermore, another study confirmed a correlation between the expression levels of lncRNA-MALAT 1 in samples from adipose tissue, blood or urine and obesity or other metabolic-related diseases 34 . This study observed a significant upregulation of lncRNA-MALAT 1 expression in the 3 T 3-L 1 cell model, while treatment with different concentrations of picroside led to a gradual decrease in lncRNA-MALAT 1 expression in the 3 T 3-L 1 cell model, exhibiting concentration-dependent characteristics. MicroRNAs (miRNAs) are single-stranded small RNA molecules approximately 21 to 23 nucleotides in length. Most lncRNAs share structural similarities with mRNAs, suggesting that miRNAs may negatively regulate lncRNA expression through mechanisms similar to mRNA regulation, thus exerting biological functions. The LncRNAs competitively bind to the 3'-UTR of target gene mRNAs with miRNAs, indirectly inhibiting the negative regulation of target gene mRNA by miRNAs. The miR-21 may be one of the target mRNAs of lncRNA-MALAT 1 35 . Studies have compared the expression levels of miR-21 between patients with GDM and normal pregnant women, revealing significant differences in miR-21 expression levels between GDM patients and normal pregnant women 36 . In GDM, insulin resistance and impaired pancreatic $ -cell function are involved. Changes in miR-21 expression may participate in the occurrence of GDM by affecting insulin signal transduction and pancreatic $ -cell function. The miR-21 may regulate key genes and signaling pathways during adipocyte differentiation and maturation, thereby affecting the synthesis and storage of fatty acids within adipocytes 37 Elevated levels of miR-21 expression may be observed in obese and metabolically disturbed individuals, where its 1072

[[[ p. 12 ]]]

[Summary: This page discusses how miR-21 may regulate key genes and signaling pathways during adipocyte differentiation, affecting fat synthesis. It also describes how PPAR-γ plays a role in regulating insulin sensitivity and that its activity may be suppressed in GDM. It also discusses the role of C/EBP-' and FAS in fat synthesis. This study found that picroside may promote the expression of PPAR-γ to restore the process of fat synthesis.]

Int. J. Pharmacol., 20 (6): 1063-1075, 2024 upregulation is associated with abnormal fat storage and lipid metabolism, further influencing the process of fat synthesis. Researchers such as Calo et al 38 found that miR-21 can interfere with fat synthesis processes by targeting molecules such as glucocorticoid receptors, PPAR- γ and its coactivators This study observed a significant downregulation of miR-21 expression in the 3 T 3-L 1 cell model, while treatment with different concentrations of picroside led to a gradual increase in miR-21 expression in the 3 T 3-L 1 cell model, exhibiting concentration-dependent characteristics. This suggests that picroside may have a regulatory effect on the expression of lncRNA-MALAT 1 and miR-21 in GDM The PPAR- γ is a nuclear receptor that plays a crucial role in regulating insulin sensitivity in adipose tissue and pancreatic $ -cells. In GDM, the activity of PPAR- γ in adipocytes and pancreatic $ -cells may be suppressed, leading to insulin resistance. The GDM patients often exhibit increased inflammation and the downregulation of PPAR- γ may be associated with enhanced inflammatory response 39 . The C/EBP- " is a key transcription factor that plays an important role in adipocyte differentiation and function. The expression levels of C/EBP- " are lower in GDM patients, which may inhibit adipocyte differentiation and subsequently affect the process of fat synthesis 40 . The FAS is a key enzyme in fatty acid synthesis and participates in the process of fatty acid synthesis. The expression levels of FAS are lower in GDM patients, which may lead to inhibition of fatty acid synthesis and affect fat synthesis. The ACC is another important regulatory enzyme in fatty acid synthesis 41,42 . The ACC participates in the synthesis of acetyl-CoA, which is a key step in fatty acid synthesis. Lower expression levels of ACC in GDM may lead to reduced synthesis of acetyl-CoA, thereby affecting the process of fat synthesis 43 . This study found that the expression of FAS, C/EBP- " , PPAR- γ and ACC was significantly downregulated in the 3 T 3-L 1 cell model, while treatment with different concentrations of picroside led to a gradual increase in the expression of FAS, C/EBP- " , PPAR- γ and ACC in the 3 T 3-L 1 cell model, exhibiting concentration-dependent characteristics. Picroside may promote the expression of PPAR- γ to restore the process of fat synthesis 44 . Additionally, picroside can regulate adipocyte differentiation and fatty acid synthesis by affecting the PPAR- γ signaling pathway and the expression of related regulatory proteins CONCLUSION The work investigated the role of picroside in GDM fat synthesis and the roles played by lncRNA-MALAT 1, miR-21 and PPAR- γ SPW in this process. The outcomes in this work revealed that picroside effectively downregulated of TC, TG and lncRNA-MALAT 1 in patients with GDM, while simultaneously upregulating PPAR- γ , C/EBP- " , FAS and ACC This suggested that picroside regulated the involvement of lncRNA-MALAT 1/miR-21/PPAR- γ SPW in fat synthesis of patients with GDM. However, this work also was subjected to some limitations, as it only utilized human subcutaneous adipocytes for experimentation and lacked validation of its findings through animal models or clinical studies. Additionally, it could further explore specific molecular mechanisms and biological processes to deepen the understanding of picrosideʼs role in regulating fat synthesis. Nevertheless, this work presented significant importance for gaining deeper insights into the pathological mechanisms of GDM and identifying new therapeutic strategies. Furthermore, it offered new insights and directions for the application of picroside and related SPW research SIGNIFICANCE STATEMENT This study primarily investigated the regulatory effect of picroside on fat synthesis in Gestational Diabetes Mellitus (GDM) patients and analyzed its role in modulating the lncRNA-MALAT 1, miR-21 and PPAR- γ signaling pathways. The results demonstrated that picroside reduced triglyceride and total cholesterol levels in fat cells of GDM through modulation of the lncRNA-MALAT 1/miR-21/PPAR- γ signaling pathway, thereby participating in the regulation of fat synthesis. These findings hold significant implications for a deeper understanding of the pathophysiological mechanisms underlying GDM and the exploration of relevant intervention strategies. Subsequent research should further investigate the potential application value of picroside in diabetes treatment and disease management REFERENCES 1 Alfadhli, E.M., 2015. Gestational diabetes mellitus. Saudi Med. J., 36: 399-406 2 Sweeting, A., J. Wong, H.R. Murphy and G.P. Ross, 2022. A clinical update on gestational diabetes mellitus. Endocr. Rev., 43: 763-793 3 Lende, M. and A. Rijhsinghani, 2020. Gestational diabetes: Overview with emphasis on medical management. Int. J. Environ. Res. Public Health, Vol. 17. 10.3390/ijerph 17249573 4 Rasmussen, L., C.W. Poulsen, U. Kampmann, S.B. Smedegaard, P.G. Ovesen and J. Fuglsang, 2020. Diet and healthy lifestyle in the management of gestational diabetes mellitus. Nutrients, Vol. 12. 10.3390/nu 12103050 1073

[[[ p. 13 ]]]

[Summary: This page lists references for the study, citing various articles related to gestational diabetes mellitus, picroside, and related molecular mechanisms.]

Int. J. Pharmacol., 20 (6): 1063-1075, 2024 5 Johns, E.C., F.C. Denison, J.E. Norman and R.M. Reynolds, 2018. Gestational diabetes mellitus: Mechanisms, treatment, and complications. Trends Endocrinol. Metab., 29: 743-754 6 Kamana, K.C., S. Shakya and H. Zhang, 2015. Gestational diabetes mellitus and macrosomia: A literature review Ann. Nutr. Metab., 66: 14-20 7 Valero, P., G. Fuentes, M. Cornejo, S. Vega and A. Grismaldo et al ., 2022. Exposome and foetoplacental vascular dysfunction in gestational diabetes mellitus Mol. Aspects Med., Vol. 87. 10.1016/j.mam.2021.101019 8 Liu, Y., R. Sun, X. Lin, L. Wu and H. Chen et al ., 2022 Procyanidins and its metabolites by gut microbiome improves insulin resistance in gestational diabetes mellitus mice model via regulating NF- 6 B and NLRP 3 inflammasome pathway. Biomed. Pharmacother., Vol. 151 10.1016/j.biopha.2022.113078 9 Zhou, Y., R. Zhao, Y. Lyu, H. Shi and W. Ye et al ., 2021 Serum and amniotic fluid metabolic profile changes in response to gestational diabetes mellitus and the association with maternal-fetal outcomes. Nutrients, Vol. 13 10.3390/nu 13103644 10. Liu, Y., B. Wang, S. Shu, Z. Li and C. Song et al ., 2021. Analysis of the Coptis chinensis genome reveals the diversification of protoberberine-type alkaloids. Nat. Commun., Vol. 12 10.1038/s 41467-021-23611-0 11. Chen, Q., R. Ren, Q. Zhang, J. Wu and Y. Zhang et al ., 2021 Coptis chinensis Franch polysaccharides provide a dynamically regulation on intestinal microenvironment, based on the intestinal flora and mucosal immunity J. Ethnopharmacol., Vol. 267. 10.1016/j.jep.2020.113542 12. Li, T., L. Xu, R. Zheng, X. Wang, L. Li, H. Ji and Q. Hu, 2020 Picroside II protects against cholestatic liver injury possibly through activation of farnesoid X receptor. Phytomedicine, Vol. 68. 10.1016/j.phymed.2019.153153 13. Piao, X., X. Sui, B. Liu, T. Cui and Z. Qi, 2021. Picroside II improves severe acute pancreatitis-induced hepatocellular injury in rats by affecting JAK 2/STAT 3 phosphorylation signaling. BioMed Res. Int., Vol. 2021. 10.1155/2021/9945149 14. Ma, S., X. Wang, F. Lai and C. Lou, 2020. The beneficial pharmacological effects and potential mechanisms of picroside II: Evidence of its benefits from in vitro and in vivo . Biomed. Pharmacother., Vol. 130 10.1016/j.biopha.2020.110421 15. Piao, X., B. Liu, X. Sui, S. Li and W. Niu et al ., 2020. Picroside II improves severe acute pancreatitis-induced intestinal barrier injury by inactivating oxidative and inflammatory TLR 4-dependent PI 3 K/AKT/NF- 6 B signaling and improving gut microbiota. Oxid. Med. Cell. Longevity, Vol. 2020 10.1155/2020/3589497 16. Yang, X., W. Gao, B. Wang, X. Wang and H. Guo et al ., 2017 Picroside II inhibits RANKL-mediated osteoclastogenesis by attenuating the NF- κ B and MAPKs signaling pathway in vitro and prevents bone loss in lipopolysaccharide treatment mice. J. Cell. Biochem., 118: 4479-4486 17. Li, H., W. Du, Y. Yuan, J. Xue, Q. Li and L. Wang, 2022 The protective effect of picroside II on isoflurane-induced neuronal injury in rats via downregulating miR-195. Neuroimmunomodulation, 29: 202-210 18. Dhami-Shah, H., R. Vaidya, M. Talwadekar, E. Shaw, S. Udipi, U. Kolthur-Seetharam and A.D.B. Vaidya, 2021. Intervention by picroside II on FFAs induced lipid accumulation and lipotoxicity in HepG 2 cells. J. Ayurveda Integr. Med., 12: 465-473 19. Qin, Z., W. Wang, D. Liao, X. Wu and X. Li, 2018 UPLC-Q/TOF-MS-based serum metabolomics reveals hypoglycemic effects of Rehmannia glutinosa , Coptis chinensis and their combination on high-fat-diet-induced diabetes in KK-Ay mice. Int. J. Mol. Sci., Vol. 19. 10.3390/ijms 19123984 20. Wang, Y., Y.R. Mo, J. Tan, L.X. Wu, Y. Pan and X.D. Chen, 2022 Effects of growing Coptis chinensis Franch in the natural understory vs . under a manmade scaffold on its growth, alkaloid contents, and rhizosphere soil microenvironment. PeerJ, Vol. 10. 10.7717/peerj.13676 21. Li, Q., M. Wang, X. Yuan, D. Li and H. Xu et al ., 2021. Study on the adsorption and desorption performance of magnetic resin for Congo red. Environ. Technol., 42: 1552-1559 22. Cheng, C., R. Guo, J. Lan and S. Jiang, 2017. Extraction of lotus fibres from lotus stems under microwave irradiation. R. Soc. Open Sci., Vol. 4. 10.1098/rsos.170747 23. Tang, B., X. Chen, P. Laborda and F. Liu, 2021. Efficient direct preparation of antifungal alteramide B from Lysobacter enzymogenes fermentation broth by macroporous resin adsorption. Bioresour. Technol., Vol. 319. 10.1016/j.biortech.2020.124220 24. Venkiteshwaran, K., E. Wells and B.K. Mayer, 2020. Kinetics, affinity, thermodynamics, and selectivity of phosphate removal using immobilized phosphate-binding proteins. Environ. Sci. Technol., 54: 10885-10894 25. Niphadkar, S.S. and V.K. Rathod, 2017. Adsorption kinetics, isotherm, and thermodynamics studies of acetyl-11-keto- $ - boswellic acids (AKBA) from Boswellia serrata extract using macroporous resin. Prep. Biochem. Biotechnol., 47: 804-812 26. Marin, N.M. and I. Stanculescu, 2021. Application of amberlite IRA 402 resin adsorption and laccase treatment for acid blue 113 removal from aqueous media. Polymers, Vol. 13. 10.3390/polym 13223991 27. Lanjekar, K.J. and V.K. Rathod, 2024. Recovery and separation of glycyrrhizic acid from natural deep eutectic solvent (NADES) extract by macroporous resin: Adsorption kinetics and isotherm studies. Prep. Biochem. Biotechnol., 54: 39-48 1074

[[[ p. 14 ]]]

[Summary: This page continues listing references for the study, citing various articles related to gestational diabetes mellitus, picroside, and related molecular mechanisms.]

Int. J. Pharmacol., 20 (6): 1063-1075, 2024 28. Cho, Y., Y. Chang, S. Ryu, S.H. Wild and C.D. Byrne, 2023 Synergistic effect of non-alcoholic fatty liver disease and history of gestational diabetes to increase risk of type 2 diabetes. Eur. J. Epidemiol., 38: 901-911 29. Xu, W., M. Tang, J. Wang and L. Wang, 2020 Anti-inflammatory activities of puerarin in high-fat diet-fed rats with streptozotocin-induced gestational diabetes mellitus. Mol. Biol. Rep., 47: 7537-7546 30. Karasek, D., V. Kubickova, O. Krystynik, D. Goldmannova, L. Cibickova and J. Schovanek, 2020. Circulating levels of selected adipokines in women with gestational diabetes and type 2 diabetes. J. Appl. Biomed., 18: 54-60 31. Song, X., C. Wang, T. Wang, S. Zhang and J. Qin, 2023. Obesity and risk of gestational diabetes mellitus: A two-sample Mendelian randomization study. Diabetes Res. Clin. Pract., Vol. 197. 10.1016/j.diabres.2023.110561 32. Cremer, S., K.M. Michalik, A. Fischer, L. Pfisterer and N. Jaé et al ., 2019. Hematopoietic deficiency of the long noncoding RNA MALAT 1 promotes atherosclerosis and plaque inflammation. Circulation, 139: 1320-1334 33. Li, H., Q. Zhao, L. Chang, C. Wei and H. Bei et al ., 2019. LncRNA MALAT 1 modulates ox-LDL induced EndMT through the Wnt/ $ -catenin signaling pathway. Lipids Health Dis., Vol. 18 10.1186/s 12944-019-1006-7 34. Liu, S.X., F. Zheng, K.L. Xie, M.R. Xie, L.J. Jiang and Y. Cai, 2019 Exercise reduces insulin resistance in type 2 diabetes mellitus via mediating the lncRNA MALAT 1/microRNA-382-3 p/resistin axis. Mol. Ther. Nucleic Acids, 18: 34-44 35. Huang, B., X. Guo and Y. Li, 2020. lncRNA MALAT 1 regulates the expression level of miR-21 and interferes with the biological behavior of colon cancer cells. J. BUON, 25: 907-913 36. Chartoumpekis, D.V., A. Zaravinos, P.G. Ziros, R.P. Iskrenova, A.I. Psyrogiannis, V.E. Kyriazopoulou and I.G. Habeos, 2012. Differential expression of microRNAs in adipose tissue after long-term high-fat diet-induced obesity in mice. PLoS ONE, Vol. 7. 10.1371/journal.pone.0034872 37. Xia, L., Z. Zhao, X. Yu, C. Lu and P. Jiang et al ., 2021. Integrative analysis of miRNAs and mRNAs revealed regulation of lipid metabolism in dairy cattle. Funct. Integr. Genomics, 21: 393-404 38. Calo, N., P. Ramadori, C. Sobolewski, Y. Romero and C. Maeder et al ., 2016. Stress-activated miR-21/miR-21* in hepatocytes promotes lipid and glucose metabolic disorders associated with high-fat diet consumption Gut, 65: 1871-1881 39. Lu, J., D. Wang, B. Ma, X. Gai, X. Kang, J. Wang and K. Xiong, 2022. Blood retinol and retinol-binding protein concentrations are associated with diabetes: A systematic review and meta-analysis of observational studies Eur. J. Nutr., 61: 3315-3326 40. Tian, H., J. Luo, P. Guo, C. Li and X. Zhang, 2023 C/EBP " promotes triacylglycerol synthesis via regulating PPARG promoter activity in goat mammary epithelial cells J. Anim. Sci., Vol. 101. 10.1093/jas/skac 412 41. Su, K., B. Yi, B.Q. Yao, T. Xia, Y.F. Yang, Z.H. Zhang and C. Chen, 2020. Liraglutide attenuates renal tubular ectopic lipid deposition in rats with diabetic nephropathy by inhibiting lipid synthesis and promoting lipolysis. Pharmacol. Res., Vol. 156. 10.1016/j.phrs.2020.104778 42. Seo, Y.J., K.J. Kim, J. Choi, E.J. Koh and B.Y. Lee, 2018 Spirulina maxima extract reduces obesity through suppression of adipogenesis and activation of browning in 3 T 3-L 1 cells and high-fat diet-induced obese mice. Nutrients, Vol. 10. 10.3390/nu 10060712 43. Bates, J., A. Vijayakumar, S. Ghoshal, B. Marchand and S. Yi et al ., 2020. Acetyl-CoA carboxylase inhibition disrupts metabolic reprogramming during hepatic stellate cell activation. J. Hepatol., 73: 896-905 44. Adibi, J.J., J.P. Buckley, M.K. Lee, P.L. Williams and A.C. Just et al ., 2017. Maternal urinary phthalates and sex-specific placental mRNA levels in an urban birth cohort Environ. Health, Vol. 16. 10.1186/s 12940-017-0241-5 1075

Other Health Sciences Concepts:

[back to top]

Discover the significance of concepts within the article: ‘Effects of Picroside Regulating the lncRNA-MALAT1/miR-21/PPAR Signaling...’. Further sources in the context of Health Sciences might help you critically compare this page with similair documents:

Acc-, Fa, Exercise, Adipose Tissue, Obesity, Traditional Chinese medicine, Diabetes, Lotus-fibre, Statistical analysis, Clinical studies, High performance liquid chromatography, High Performance Liquid Chromatography (HPLC), Insulin resistance, Puerarin, Anti-inflammatory activities, Animal model, Farnesoid x receptor, Atherosclerosis, Total cholesterol, Particle size, Gut microbiota, Type 2 diabetes, Diabetic Nephropathy, Non Alcoholic Fatty Liver Disease, Disease management, Fat metabolism, Hyperglycemia, Lipid metabolism, Insulin secretion, Intervention strategies, Glucose metabolism, Blood glucose level, Pathological mechanism, High-fat diet, Inflammatory response, Gestational diabetes, Therapeutic strategies, Diabetes treatment, High Fat Diet induced obesity, Gestational Diabetes Mellitus, Triglyceride, Regulatory proteins, Lipid accumulation, Gestational hypertension, Lipid metabolism disorder, Soxhlet extraction method, Biological processes, Microwave irradiation, Cell lysis, Intestinal flora, Molecular mechanism, Bone loss, Phthalates, Petroleum ether fraction, Chromatographic column, Extraction efficiency, Extraction time, Western blotting, Fatty acid, Ethanol, Reference Standard, Resistin, Dairy cattle, Insulin signaling pathway, Tumor cell growth, Total cholesterol (TC), Adsorption kinetics, Active component, HepG2 cell, Extraction yield, Fatty acid metabolism, Metabolic abnormalities, Ethanol concentration, Acid Blue 113, Hepatocyte, Picroside II, Adipocyte differentiation, Adipogenesis, Triglyceride (TG), Osteoclastogenesis, Retinol, MicroRNA, Ethanol Solution, Protein expression, Lipopolysaccharide, Lipid synthesis, Congo red, Lipotoxicity, Mucosal immunity, Hepatocellular injury, Extraction cycles, Protein level, FFA, Adipokine, Fatty acid synthesis, Lipolysis, Metabolic Reprogramming, DMEM medium, Pathophysiological mechanism, Ox - LDL, Insulin signal transduction, Number of extractions, Neuronal Injury, PPAR gamma, MRNA, TG, TC, Internal reference, MiR-21, Adipocyte, GDM, Adipose tissue inflammation, Glycyrrhizic acid, Fat cell, Renal tubular, 3 T 3-L 1 cell, Acetyl-CoA, Retinol-binding protein, Colon cancer cell, Solvent volume, PPAR, Hepatic stellate cell activation, Protein band, Signaling pathway, PPAR signaling pathway, Pancreatic beta-cell function, High-fat diet-induced obese mice, NLRP3 inflammasome pathway, MiR-195, Phosphate removal, Isotherm studies, Laccase treatment, Cell treatment, Regulatory effect, Metabolic-related diseases, GDM patients.

Let's grow together!

I humbly request your help to keep doing what I do best: provide the world with unbiased sources, definitions and images. Your donation direclty influences the quality and quantity of knowledge, wisdom and spiritual insight the world is exposed to.

Let's make the world a better place together!

Like what you read? Help to become even better: