Aqueous Extracts of Purple Sweet Potato Attenuate Weight Gain in High Fat-fed...

[Full title: Aqueous Extracts of Purple Sweet Potato Attenuate Weight Gain in High Fat-fed Mice]

[Find the meaning and references behind the names: Life, Data]

Life International Journal of Pharmacology ISSN 1811-7775 Life science alert ansinet Asian Network for Scientific Information

[Find the meaning and references behind the names: Story, Element, Tnt, Park, Acs, Bae, Doi, Gain, Coa, Key, Standard, Fatty, Kwon, Shin, Body, Million, Woo, Memory, Liver, Ahn, Noh, Diet, Eberle, Fed, Chow, Master, High, Fal, Horton, Jung, Genes, Acid, Unger, Hyun, Purple, Plays, Play, Novo, Fat, Fas, Wee, Role, Free, Sweet, Milla, Naju, Author, Lower, Study, Factor, Tel]

International Journal of Pharmacology 9 (1): 42-49, 2013 ISSN 1811-7775 DOI: 10.3923/ijp.2013.12.19 2013 Asian Network for Scientific Information Aqueous Extracts of Purple Sweet Potato Attenuate Weight Gain in Iligh Fat-fed Mice S.J. Shin, U.J. Bae, M. Ahn, S.O. Ka, S.J. Woo, S.O. Noh, Y.S. Kwon, K.H. Jung, J.H. Wee and B.H. Park 'BioFood Story Inc., 477 Jeonjucheon-seoro, Wansan-gu, Jeonju, Jeonbuk 560-821, Republic of Korea *Department of Biochemistry, Department of Opthalmology, Chonbuk National University Medical School, 567 Baekje-daero, Deokjin-gu, Jeonju, Jeonbuk 561-756, Republic of Korea *Jeonnam Biofood Technology Center, 30-5, Dongsunonggongdanji-ro, Naju, Jeonnam 520-330, Republic of Korea Abstract: Purple sweet potato is a widely consumed food around the world has been reported to possess antioxidant, antimutagenic and memory-enhancing effects. However, antiobesity effect of PSP is not clear. The objective of this study was to determine the effects of Purple Sweet Potato Extracts (PSPE) on serum and fecal lipid profiles, body weight gain, boxly fal percentage and hepatic lipogenesis. Mice were administered a standard chow diet, a 15% high-fat diet, or a high-fat diet with various doses of PSPE. Mice that were fed a high-fat diet containing PSPE were found to have lower increases in body and adipose tissue weights and lessened occurrences of hepatic steatosis than mice that were fed a high-fat diet without PSPE. The decreased adiposity induced by PSPE accounted for lower serum levels of leptin and a higher adiponectin leptin ratio. PSPE administration also resulted in a significant decrease in serum and hepatic triglyceride and cholesterol levels and a significant increase in fecal triglyceride and cholesterol levels when compared to the high-fat group. To identify the mechanism by which PSPE induced its antiobesity effect, the expression of lipogenesisrelated genes that were induced in high fat-fed mice was investigated. PSPE suppressed the expression of Sterol Regulatory Element-Binding Protein (SREBP-1, Acyl-CoA Synthase (ACS), Glycerol-3-phosphate Acyltransferase (GPAT), HMG-CoA Reductase (HMGR) and Fatty Acid Synthase (FAS) in liver tissue in mice provided the high-fat diet. These findings suggest that the antiobesity effect of PSPE in high fat-fed mice occurs through its modulation of lipogenesis in the liver and inhibition of dietary lipid absorption. Key words: Purple sweet potato, high-fat diet, obesity, de novo lipogenesis, fecal lipid excretion INTRODUCTION Obesity results from an imbalance between fully acid synthesis and oxidation. The World Health Organization estimates that more than 1 billion adults worldwide are overweight and at least 300 million of them are clinically obese. It increases the prevalence of insulin resistance. hepatic steatosis, hypertension and cancer (Unger, 2003). An excessive release of free fatty acids and adipocytokines such as leptin and Tumor Necrosis Factor (TNT)- from adipocytes in visceral fat affects lipid. metabolism in the liver (Milla et al., 2008). Sicrol Regulatory Element-Binding Proteins (SREBPs) are master transcription factors for de novo lipogenesis (Eberle et al., 2001). The three SREBP isoforms, SREBP-1a, SREBP-1c and SREBP-2, play different roles in lipid synthesis. Studies using transgenic and knockout mice suggest that SREBP-1e plays an essential role in the regulation of most. lipogenic genes involved in fatty acid and triglyceride synthesis (Foretz et al., 1999; Horton et al., 2002). whereas SRHBP-2 predominantly regulates cholesterol synthesis (Iorton et al., 1998) and SREBP-1a is involved in both pathways (Horton et al., 2003). It has also been reported that peroxisome proliferator-activated receptor (PPAR)-y increases the expression of lipogenic genes (Tontonoz et al., 1994). Corresponding Author: Byung-Hyun Park, Department of Biochemistry, Chonbuk National University Medical School, 567 Backjo-dacro, Deokjin-gu, Jeonju, Jeonbuk 561-756, Republic of Korea. Tel: 82-63-270-3139, 82-63-274-9833 42

[Find the meaning and references behind the names: Every, Gan, Natural, Real, Four, Chet, Human, Cho, Deg, Ast, Hfd, Left, Care, Day, Freeze, Normal, Male, Polato, Lobe, Int, Low, Risk, Final, Long, Lab, Time, Central, Germany, Oral, Under, Blood, Nmr, Snap, Hwang, Days, Success, Vena, Cross, Energy, Sample, Given, Dark, Market, Table, Due, Alt, Milk, Light, Oil, Weeks, Min, Positive, James, End, Cava, Diel]

Int. J. Pharmacol., 9 (1): 42-49, 2013 Although, a number of drugs have been developed in recent years to treat obesity, only orlistat, an inhibitor of pancreatic lipases and sibutramin, a serotoninnoradrenalin reuptake inhibitor, have been approved for long-term use. Ilowever, sibutramin has been withdrawn from the market due to an increased risk of cardiovascular side effects such as myocardial infarction and stroke, leaving orlistat as the only drug currently available (James et al., 2010). Due to the limited success of pharmacotherapy, there is increasing interest in the exploration of natural products as alternative therapies. We have been searching for natural products that have weight and lipid-lowering effects. Recently, there has been increasing interest in the health benefits of purple sweel polato (PSP, Ipomoea batatas L.), a widely consumed food around the world. Studies using experimental models have demonstrated that PSP possesses antioxidant (Ye et al., 2010; Gan et al.. 2012), animulagenic (Yoshimoto et al., 1999) and memory-enhancing effects (Cho et al., 2003). PSP also reduces hepatic lipid accumulation in high fat-fed mice (Hwang et al., 2011), inhibits the uptake of oxidized Low-Density Lipoprotein (LDL) into human macrophages (Park et al., 2010) and reduces acetaminophen-induced liver damage (Yoshimoto et al., 1999). These beneficial effects of PSP are at least partly attributed to anthocyanin, which is abundant in PSP. However, an antiobesity effect of PSP has not yet been reported. Therefore, this study was conducted to examine the effectiveness of aqueous extracts from PSP (PSPE) for improving blood lipid profiles and reducing body fat accumulation in mice with obesity induced by a Iligh-Fat Diet (HFD), MATERIALS AND METHODS Animals: Four-week-old male C57BL/6J mice were purchased from Central Lab Animal Inc. (Seoul, Korea). The mice were housed al 20°C, 50% relative humidity and under a 12-h light-dark cycle (light cycle from 6:00 AM to 6:00 PM) and were provided free access to drinking water. The animals were fed a Nomal Diel. (ND) group: 16, 20 and 64% of energy from fal protein and carbohydrate. respectively), a high-fat chet (HF group: 45, 20 and 35% ol energy from fal, protein and carbohydrate, respectively), or a high-fat diet with PSPE (HF-PSPF group: 100, 250, or 500 mg kg) for 16 weeks. The HF-PSPH group was initially fed the HF dict for 8 weeks and then administered PSPE for another 8 weeks via oral gavage two times per day. Garcinia cambogia extract (GCE) (250 mg kg) was used as positive control (Heymsfield et al., 1998). All groups had 10 mice each. Diets were custom-made by research diets, detailed diet compositions are given in Table 1. Food consumption and body weight were recorded every 3 days. At the end of the experimental period, the animals were sacrificed by decapitation, after Table 1: Composition of the diet. Fal (% energy) kcal kg Normal diet Iligh fat diet 16 45 Carbohydrate (% energy) Protein (energy) 64 35 20 20 1,000 1,000 Normal dict High fat dict Ingredient gkekcal g ke kcal Casein (from milk) 200 800 200 800 Can starch 397 1,590 155 620 100 400 50 200 132 528 132 528 50 50 70 630 25 225 Mineral mixture 35 35 Vitamin mixture 10 40 10 40 L-cystine 3 12 3 12 Choline bitartrate Lard 2.5 2.5 175 1,575 Sucrose Dextrose Cellulose Soybean oil which blood samples were collected from the inferior vena cava. Adipose tissue (epididymal, subcutaneous and interscapular) and liver were removed, weighed. snap-frozen and stored at -80°C. Left lateral lobe of liver was used for liver TG and real time RT-PCR analyses. All experimental procedures were approved by the Institutional Animal Care and Use Committee at Chonbuk National University. Preparation of PSPE: PSP was obtained from Jeonnam Biofood Technology Center in Naju, Korea. For extraction 100 g of PSP was washed, sliced and then placed in boiling water for 90 min. Next, the sample was centrifuged at 4,410xg for 20 min and the supernatant was concentrated to 200 mL under reduced pressure. The concentrated supernatant was then freeze-dried to a final weight of 25.1 g and stored at -70°C until used. Nuclear magnetic resonance (NMR) measurement of body fat: The percentage of body fat was determined using a Bruker Minispec mq7.5 NMR analyzer (Bruker Optics, Ettlingen, Germany). Mice were placed in a clear, plastic cylinder (50 mm diameter) and kept. immobile by insertion of a tight-fitting plunger into the cylinder. The lube was then lowered into the sample chamber of the instrument for the duration of the scan, which was approximately 2 min. The accuracy and precision of both instruments were cross-calibrated by measuring the same groups of mice with different. adiposity. Biochemical analysis: Serum levels of triglyceride, total cholesterol, HDL cholesterol, LDL cholesterol, AST and ALT were determined using a biochemical autoanalyzer (Hitachi 760-110, Autoanalyzer, Japan). Glucose, insulin, leptin and adiponectin were analyzed using commercially 43

[Find the meaning and references behind the names: Lee, Pharm, Level, Rna, Fig, Kit, Tas, Miti, Gene, Foster, Dose, Abi, Homa, Duncan, Forward, Micro, Iii, Asan, Matthews, Folch, Mass, Sec, Strand, Stm, Mean, Dala, Elisa]

Int. J. Pharmacol., 9 (1): 42-49, 2013 available ELISA kits (Shibayagi, Japan). Insulin resistance was evaluated by the homeostasis model of insulin resistance (IIOMA-IR) formula (Matthews et al., 1985): IIOMA-IR = Semum glucose level (mg dxinsulin level (mITI T.1) 105 A high HOMA-IR score indicates high insulin resistance. Measurement of hepatic and fecal lipid concentrations: Total lipids in the liver and feces were extracted according to the method of Folch et al. (1957). Aliquots of the extracted hepatic lipids were used for the measurement of the triglyceride and total cholesterol concentrations and the commercial assay kits were used for serum lipids. Feces were collected for 18 h during the final week of feeding and freeze-dried. The extracted total hepatic and fecal lipids were assayed with a commercial kit (Asan Pharm, Seoul, Korea). RNA isolation and real-time RT-PCR: RNA was isolated from the liver 11ssue Using Trizol Teagent. (Invitrogen, Carlsbad, CA, USA). RNA was then precipitated with isopropanol ankl dissolved 111 DEPC-treated distilled water. Next, total RNA (2 µg) was treated with RNase-free DNase (Invitrogen) and first-strand cDNA was generated using the random Table 2: Sequences and accession numbers for primers used in real-time RT-PCR Primer AC'S Sequences for primers GCTGAACTGACACACCTGGA AACTTGGCGACAAAGTTGCT GPAT TCCTCCGATATTCTTCTCCC ACTGGAGCCGAGCCTCAC HMGR CACAATAACTTCCCAGGGGT GGCCTCCATTGAGATCOG TAS TGATCTGGAACACAGCAAGG GGCTGTGGTGACTCTTAGIGATAA SREBP-1 GGTTTTGAACGACATCGAAGA CGGGAAGTCACTGTCTTGGT PPAR-Y GAAAGACAACGGACAAATCACC GGGGGTGATATGTTTGAACTTG Accession gene No. NM_019811 NM_018713 NM_008255 NM_007988 NM_011480 NM 011146 ACS: Acyl CoA synthase, GPAT: Glycerol-3-phosphate acyltransferase, HMGR: HMG-CoA reductase, FAS: Fatty acid synthase, SREBP-1: Sterol regulatory element binding protein PPAR-Y: Peroxisome proliferator-activated receptor-y hexamer primer provided in the first-strand cDNA synthesis kit (Applied Biosystems, Foster City, CA, USA). Specific primers for each gene (Table 2) were designed using primer express software (Applied Biosystems). The sequence for the control 18S ribosomal RNA was purchased from Applied Biosystems and used as the invariant control. The real-time RT-PCR reaction, which was contained in a final volume of 10 μL, consisted of 10 ng of reverse transcribed total RNA, 167 nM of forward and reverse primers and 2×PCR master mixtures. The condition for PCR reaction was as follows: Denaturation at 95°C for 15 sec and annealing at 60°C for 1 min The PCR reaction was performed in 384-well plates using the ABI Prism 7900 HT Sequence detection system (Applied Biosystems) (Lee et al., 2011). All reactions were conducted in triplicate. Statistical analysis: Statistical analysis of the dala was performed using one-way ANOVA followed by Duncan's test.. Differences with a p<0.05 were considered statistically significant.. RESULTS PSPE inhibited body weight and adipose tissue mass gain: In our preliminary study, PSPE supplementation at 100, 250, or 500 mg kg for 4 weeks improved serum lipid parameters in mice fed III diet (data not shown). We therefore hypothesized that PSPE supplementation might has an anti-obesity effect after longer period of III diet. The body weight gain during the experimental period is shown in Fig. 1a. The body weight of the II group was significantly higher than that of the ND group after 6 weeks of feeding and remained significantly higher for the duration of the experiment. The HF-PSPE group had significantly lower body weight than the HF group from the 10th week to the end of the experiment, indicating that PSPE reduced weight gain. In addition, at the end of the experiment, the weight gain of the HF group (23. 3.7 12.3 g) was significantly greater than that of the ND group (17.1-2.2 g), although, this increase in weight gain was attenuated by PSPE consumption in a dose-dependent. mammer (Table 3). No significant difference in food intake Table 3: Effects of PSIE supplementation on body weight. food intake and tissues weight in high fat fed mice IIT-PSPT (mg kg ') Initial body weight (g) ND 21.7±0.6 Final body weight (g) 38.8+2.8 Food intake (g day ') 2.98±0.16 TER (10) 5.3110.18 HF 21.9±0.7 45.6+3.0* 3.11±0.22 7.34 10.21 100 250 20.8±1.1 46.0+2.1 3.13±0.36 20.8-1.7 43.7-3.5 500 21.1±0.5 42.5+2.1* GCE(250kg¯) 21.5±1.3 45.0+2.7 3.02-0.27 3.0±0.28 3.05±0.21 7.07.10.34 6.78 0.41" 6.3610.32 6.8710.34 'Tissue weight (g 100 g¹, but) Epididymal fat 2.70±0.23 Subcutaneous fat 1.130.17 Interscapular fat Liver 0.46±0.08 2.73+0.34 5.50±0.84* 2.90 10.16* 0.73±0.10" 4.52+0.36* 4.49±0.63 4.60 0.22" 3.60±0.43" 4.22±0.42* 2.0210.29 2.38 0.11" 1.81.10.07* 2.0910.21* 0.82±0.07 3.62+0.38* TTR: Teed efficiency ratio, Body weight gain/food intake, Values are Mean-STM (n=10), *p<0.05 vs. NT group, p<0.05 vs. I group 3.94+0.72 4.10+0.64 0.77=0.06 3.92-0.68 0.61±0.11* 0.64±0.06" 44

[Find the meaning and references behind the names: Lal, Fer, Organ, Ing, Mcan, Tul, Sem]

50 (a) 45 Int. J. Pharmacol., 9 (1): 42-49, 2013 607(b) 50Body weight (g) 40 35 30 25 ND HF HF-PSPE100 HF-PSPE250 ✰ HF-PSPE500 HF-GCE250 20 T 20 0 2 4 6 8 10 12 14 16 Table 4: Effects of PSPE supplementation on serumm, liver and fecal lipid profiles ND HF Serum Triglyceride (ing dL) Total cholesterol (mg dL) LDL-cholesterol (mg dl.-') ITDL-cholesterol (mg dl.-') ALT (TUL-¹) 61.3±5.6 171.5-16.6 48.315.3 79.0±6.3* 253.7±31.9* 113.619.4 77.2112.6 85.4119.0 5618.5 122-12.6" AST (IU LAl Liver Cholesterol (mg g 92+172 181-14.4* Time (week) HF HF-PSPE100 HF-PSPE250 HF-PSPE500 HF-GCE250 Fig. 1(a-b (a) Effects of PSPE supplementation on weight gain and adiposity in high fat-fed mice and (b) Body fat percentage, Values are Mean±SEM (n = 10), *p<0.05 vs. ND group, *p<0.05 vs. IIF group Body fat (%) 40- 30IT-PSP (mg kg) 100 250 500 GCE (250 mg kg¯¹) 75.3±11.9 221.2±11.8 98.6112.2 80.3117.1 85.0± 1.6 212.5-19.2 93.618.9 73.83.0° 201.0±12.0 86.611.0" 81.4 15.7 81.4117.4 80.3±17.1 206.8 17.0" 92.0L 10.8" 80.0 18.7 72.845.1* 97.3120.2 96.06.2 79.218.3* 121-7.4" 142+9.1* 114.3+8.0 107.0+8.7 1.26+0.10 1.97+0.18* 1.75+0.24 1.61+0.17* 1.46+0.15 1.59+0.19 3.56±0.69 5.48±0.73* 4.48±0.37* 4.38±0.52" 4.16±0.39* 4.28±0.52" Triglyceride (ing g¯¹) Feces (mg g Cholesterol (mg g ) 44.7±4.5 69.4±4.9" 54.9±6.5* 52.7±11.3 43.1±4.5" 51.5±10.6 dried feces) Triglyceride (mg g ') 1.5110.61 1.1510.11 0.97.10.09* 0.98 10.07* 0.9610.09 1.0710.07 0.9210.05 1.110.11 2.82.10.15* 2.2710.13% 2.25.10.20 2. 7910.11" Values are Mcan+SEM (-10), *p<0.05 vs. ND group. *p<0.05 vs. HF group, Al: Atherosclerosis Index; Total cholesterol-HDL cholesterol/HDL cholesterol ratio was observed among groups, but the Feed-Efficiency Ratio (FER) was significantly lower in the HF-PSPE group than in the II group (Table 3). We next measured the organ weight and body fat percentage of mice. The wet weights of the epididymal subcutaneous and interscapular fat pads in HF mice were significantly increased, by 2.06, 2.03, 1.59-fold, respectively, compared to those of the ND group (Table 3). In addition, the liver weight of the HF group was increased 1.66-fold (Table 3). Body fat percentage was measured using an NMR analyzer. Figure 1b shows that the body fat percentage of the group was significantly higher than that of the ND group. However, the supplementation of PSPE significantly decreased the weights of the fat pads and liver, as well as the body fat percentage. PSPE improved the serum, hepatic and fecal lipid profiles: Mice in the HF group had significantly higher Iriglyceride (1.28-fold), total cholesterol (1.45-fold) and LDL-cholesterol (2.35-fold) levels than mice in the ND group (Table 1). However, PSPE supplementation resulted in the reversal of the serum lipid levels to values similar to those of the ND group. In addition, the serum activity of ALT and AST was increased in the HF group, but this was significantly lowered by PSPE supplementation, suggesting that PSPE decreases hepatic injury. Consistent with the serum lipid profiles, the levels of cholesterol and lipid in liver tissues were significantly downregulated by PSPE supplementation. The group pooled fecal excretion of cholesterol and triglyceride is shown in Table 4. Interestingly, fecal cholesterol and Iriglyceride levels were significantly increased in the PSPE supplemented group. Taken together, these results suggest that the PSPE-mediated decrease in body weight can be attributed to a reduction in fal and liver masses and to an increase in fecal fat excretion, independent of food intake. 45

[Find the meaning and references behind the names: Mild, Nig, Manner]

Int. J. Pharmacol., 9 (1): 42-49, 2013 Table 5: Effects of PSPT supplementation on insulin resistance related biomarkers HF-PSPE (nig kg) ND Glucose (nig dL-') 118.2-5.8 HF 137.0+8.5* Insulin ml, ') 28.71-1.3 111.8119.2* 100 130.1=11.5 9/1.7 23.9 250 126.8+5.7 100.5 21.3 500 126.0±7.1" 57. 111. GCE (250 mg kg¯) 127.6±4.5" 62.0122.8 HOMA-IR 8.37±3.5 38.8+8.4" Leptin (ng mL) 13.2+6.6 46.3+10.4* Adiponectin (ng mL) Adiponectin leptin ratio 51.0±1.1 4.09.10.18 18.2±3.3* 1.0410.27 31.5+11.3 42.3+3.4 17.2±2.1 1.120.14 17.9±6.5 30.1+5.5* 18.0+/1.9 1.6210.25 19.5=7.8 25.8+5.0" 18.1±2.9 1.8610.11 Values are Mean±SEM (n = 10). *p<0.05 vs. ND group, "p<0.05 vs. HF group, HOMA-IR score: Fasting glucose (ing dL Fasting insulin (U mL 4105 30.4-10.3 38.6-12.1 13.0-5.0 1.13 0.31 37(a) 0 (b) 0 0 5 61(d) 87(e) (f) ND HF HF-PSPE100 HF-PSPE250 HF-PSPE500 HF-GCE250 IN HF HF-PSPE100 HF-PSPE250 HF-PSPE500 HF-GCE250 Fig. 2(a-f): Real-time PCR analyses of lipogenesis-related genes, the amount of each type of mRNA was normalized to 18S and is expressed as a percentage of the corresponding amount in the normal group. Values Mean-SEM (n = 10), *p<0.05 vs. ND group, *p<0.05 vs. II group. ACS: Acyl-CoA synthase, GPAT: Glycerol-3phosphate acyltransferase, HMGR: HMG-CoA reductase, FAS: Fatty Acid Synthase, SREBP: Sterol regulatory element-binding protein, PPAR-Y: Peroxisome proliferator-activated receptor-y PSPE lowered insulin resistance-related biomarkers: Excessive visceral fat accumulation during high-fat feeding causes a disturbance of glucose metabolism and is involved the pathogenesis of insulin resistance. Therefore, We measured insulin resistance-related biomarkers (Table 5). High fat-fed mice exhibited a mild increase in fasting blood glucose, a high serum insulin level and a high HOMA-IR. Consistent with increased adiposity, the serum level of leptin was significantly increased in the HF group, whereas the adiponectin level tended to decrease slightly in the HF group. However, PSPE supplementation returned the aforementioned parameters to levels similar to those of the ND group. PSPE reduced the expression of de novo lipogenesis genes in the liver: Having observed the suppressive effect of PSPE on body fat accumulation and serum lipid profiles, we further evaluated the effect of PSPD on the expression of lipogenic genes. Mice that were provided with the high-fat diet had higher mRNA levels of AcylCoA Synthase (ACS), glycerol-3-phosphate acy ransferase (GPAT), HMG-CoA reductase (HMGR). Fatty Acid Synthase (FAS) and SREBP-1 in their liver tissues than animals in the ND group (Fig. 2). However. the expression of lipogenic genes was reduced in a dose-dependent manner in animals given PSPE supplementation compared to those of the HD group. The 46

[Find the meaning and references behind the names: Change, Transport, Loa, Maffei, Tomas, Present, Agreement, Development, Chain, Safe, Ily, Berg, Heart, Non, Rather, Need, Tau]

Int. J. Pharmacol., 9 (1): 42-49, 2013 expression of PPAR-Y, a very important lipogenic receptor responsible for fat accumulation, was not altered by PSPE supplementation. DISCUSSION This study was designed to elucidate the potential effects of PSPE on high fat diet-induced obese animal model. Results showed that PSPE reduced body weight gain without affecting food intake and lowered the wet weights of liver and adipose tissues and the percentage of body fat. In addition, PSPE increased the fecal excretion of cholesterol and triglyceride and improved serum lipid profiles. PSPE decreased the ratio of leptin to adiponectin and attenuated the increase in serum glucose and insulin concentration. These beneficial effects of PSPE correlate with decreased de novo lipogenesis. We therefore conclude that PSPE has an antiobesity effect. Mice that were fed a high-fat diet had a greater body weight gain and body fal percentage than those that were fed the standard chow diet. However, PSPE supplementation suppressed fat accumulation, especially in the fat pads and in liver tissue, without suppressing food intake. Additionally, PSPE supplementation significantly reduced the levels of biochemical markers of liver function, including serum AST and ALT. These results suggest that PSPE protects against the development of HFD induced obesity and hepatic steatosis. Consistent with the change in body weight, supplementing high fat-fed mice with PSPE also ameliorated the increases of serum triglyceride, Loa cholesterol and LDL cholesterol. As a result, PSPE reduced the ratio of non-HDL to HDL cholesterol. commonly used as an index of risk for coronary heart disease, mainly by reducing the total cholesterol level rather than increasing the HDL cholesterol level. PSPE also significantly increased the fecal excretion of total lipids and cholesterol. Thus, PSPR-mediated reductions in serum lipid profiles and organ weights may be paτily regulated at the intestinal absorption level, thereby decreasing serum and hepatic triglyceride and cholesterol levels. Excessive visceral fat accumulation during high-fat feeding causes a disturbance in cytokine secretion from adipose tissue and is involved in the pathogenesis of insulin resistance (Unger, 2003). We therefore evaluated the two most important adipocytokines, leptin and adiponectin. Leptin behaves as a potent antiobesity hormone that regulates food intake and energy expenditure (Unger, 2001). In this study, the serum leptin level was increased in the HF group and PSPE decreased it to approximately the level observed in the ND group. The lower leptin level could be attributed to a decrease in the fat mass of mice. These changes in leptin and adiposity are in agreement with the results of previous studies that evaluated the relationship between serum leptin and the extent of adiposity in rodents and humans (Maffei et al., 1995). Adiponectin is a hormone that modulates a number of metabolic processes, including glucose and lipid homeostasis and insulin sensitivity (Berg et al., 2001; Yamauchi et al., 2001). Obesity-related decreases in serum adiponectin levels have been reported in humans (Colledge et al., 2007) and experimental animals (Macda et al., 2002, Shklyaev et al., 2003) and adiponectin has been shown to improve insulin resistance by decreasing fat content in muscle and liver tissues of obese mice (Berg et al., 2001; Yamauchi et al., 2001; Yamauchi et al., 2002). In the present study, significant differences in serum adiponectin levels were not observed among the groups. However, PSPE supplementation improved insulin sensitivity, as demonstrated by a significant reduction in serum insulin and glucose levels and HOMA-IR. The decreased ratio of leptin to adiponectin may explain the possible insulin-sensitizing and glucose-lowering effects of PSPE. To clarify the mechanism of the antiobesity activity of PSPE, we analyzed the hepatic expression of genes involved in lipid metabolism using real-time RT-PCR. PSPE supplementation led to reduced expression of lipogenic enzymes (SREBP-1, FAS and ACC1) cholesterol biosynthesis (HMG-CoA reductase) and TG biosynthesis (GPAT) in the liver tissue of mice that were fed a high-fat diel. These gene expression levels are well correlated with serum lipid profiles. Given that SREBP-1 plays a crucial role in the dietary regulation of most hepatic lipogenic genes (Eberle et al., 2001), the present findings suggest that the metabolic effects of dietary PSPE are due to the suppression of the SREBP-1-mediated lipogenic pathway. A recent study by Hwang et al. (2011) showed that anthocyanins from PSP inhibit hepatic lipid accumulation through AMP kinase (AMPK) activation. The activated AMPK further phosphorylates acetyl-CoA carboxylase, which switches off fatty acid synthesis and accelerates the transport of long-chain fatty acyl groups into the mitochondria to undergo SS-oxidation (Tomas et al., 2002). Therefore, we cannot exclude the possibility that PSPE reduced body fat accumulation and improved serum lipid profiles by activating the AMPK signaling pathway. In conclusion, the results of this study suggest that PSPE reduces body weight gain and improves the blood lipid profiles of mice that were provided a high-fat diet. Because of the limitations of currently available drugs, there is an increasing need for safe and effective dietary supplements to control body sweight. Although, 47

[Find the meaning and references behind the names: Foods, Fish, Lec, Man, Work, Gaal, Arch, Jing, Hammer, Choi, Scherer, Combs, Chung, Clin, Stanley, Sci, Allison, Chem, Hegarty, Goldstein, Lees, Greenfield, Brown, Clancy, Kang, Bossard, Major, Yoon, Aril, Ferre, Simple, England, Back, November, Bansal, Kim, Nunez, Norman, Cell, Brownlee, Bhatnagar, Hong, Med, Prima, Naylor, Coutinho, Nat, Fally, Guichard, Ilan, Yang, Maeda, Gim]

Int. J. Pharmacol., 9 (1): 42-49, 2013 furtherresearch is required to confirm that similar effects occur in humans, PSPE may be of particular benefit to individuals who are unable or unwilling to reduce their intake of high-fat foods. ACKNOWLEDGMENT This work was supported by National Research Foundation of Korea grants funded by the Korean Government (No. 2012-0009319 and 2008-0582). REFERENCES Berg, AH, T.P. Combs, X. Du, M. Brownlee and P.E. Scherer, 2001. The adipocyte-secreted protein Acrp30 enhances hepatic insulin action. Nat. Med.. 7: 947-953. Cho, L. J.S. Kang, P.H. Long, J. Jing, Y. Back and K.S. Chung, 2003. Antioxidant and memory enhancing effects of purple sweet potato anthocyanin and cordyceps mushroom extract.. Arch. Pharm. Res., 26: 821-825. Eberle, D., B. Hegarty, P. Bossard, P. Ferre and F. Foufelle. 2004. SREBP transcription factors: Master regulators of lipid homeostasis. Biochimie, 86: 839-848. Folch, J., M. Lees and G.H.S. Stanley, 1957. A simple method for the isolation and purification of total lipides from animal tissues. J. Biol. Chem., 226: 497-509. Foretz, M., C. Guichard, P. Ferre and I. Foufelle, 1999. Sterol regulatory element binding protein-lc is a major mediator of insulin action on the hepatic expression of glucokinase and lipogenesis-related genes. Proc. Natl. Acad. Sci. USA, 96: 12737-12712. Gan, L.J., D. Yang, J.A. Shin S.J. Kim and ST. Hong et al., 2012. Oxidative comparison of emulsion systems from fish oil-based structured lipid versus physically blended lipid with purple-fleshed sweet potato (Ipomoea batatas L.) extracts. J. Agric. Food Chem., 60: 467-475. Golledge, J., P. Clancy, K. Jamrozik and P.E. Norman, 2007. Obesity, adipokines and abdominal aortic aneurysm: Health in men study. Circulation, 116: 2275-2279. Heymslick, S.B., D.B. Allison, J.R. Vasselli, A. Pictrobelli, D. Greenfield and C. Nunez, 1998. Garcinia cambogia (hydroxycitric acid) as a potential antiobesity agent: A randomized controlled trial. J. Am. Med. Assoc., 280: 1596-1600. Horton, J.D., I. Shimomura, M.S. Brown, R.E. Hammer, J.L. Goldstein and H. Shimano, 1998. Activation of cholesterol synthesis in preference to fatty acid synthesis in liver and adipose of transgenic mice overproducing regulatory element-binding protein-2. J. Clin. Invest.. 101: 2331-2339 November 28, 2012 tissue sterol Horton, J.D., J.L. Goldstein and M.S. Brown, 2002. SREBPs: Activators of the complete program of cholesterol and fally acid synthesis in the liver. J. Clin. Invest., 109: 1125-1131. Horton, J.D., I. Shimomura, S. Tkemolo, Y. Bashmakov and R.E. Hammer, 2003. Overexpression of sterol regulatory element-binding protein-1a in mouse adipose tissue produces adipocyte hypertrophy. increased fatty acid secretion and fatty liver. J. Biol. Chem 278: 36652-36660. IIwang, Y.P., J.II. Choi, E.II. Ilan, II.G. Kim and J.H. Wee et al., 2011. Purple sweet potato anthocyanins attenuate hepatic lipid accumulation through activating adenosine monophosphate-activated protein kinase in human hepg2 cells and obese mice. Nutr. Res., 31: 896-906. James, W.P., L.D. Caterson, W. Coutinho, N. Finer and L.F. van Gaal et al., 2010. Effect of sibutramine on cardiovascular outcomes in overweight and obese subjects. N. England J. Med., 363: 905-917. Lee, I, J. Yu, Y. Yoon, H.J. Gim and S.M. Lee et al., 2011. [5-(3-Indol-1-ylpropoxy)-1H-indol-3-yl] acetic acid enhances adipocyte differentiation and glucose uptake in 313-L1 cells. Int. J. Pharmacol., 7: 647-652. Maeda, N., I. Shimomura, K. Kishida, H. Nishizawa and M. Malsuka et al. 2002. Diet-induced insulin resistance in mice lacking adiponectin /ACRP 30. Nat.. Med., 8: 731-737. Maffei, M., J. Ilalaas, L. Ravussin, R.E. Pratley and G.H. Lee et al., 1995. Leptin levels in human and rodent: Measurement of plasma leptin and ob RNA in obese and weight-reduced subjects. Nat. Med., 1: 1155-1161 Matthews, D.R., J.P. Hosker, A.S. Rudenski, B.A. Naylor. D.F. Treacher and R.C. Tuner, 1985. Homeostasis model assessment: Insulin resistance and B-cell function from fasting plasma glucose and insulin concentration in man. Diabetologia, 28: 412-419. Mittra, S., V.S. Bansal and P.K. Bhatnagar 2008. From a glucocentric to a lipocentric approach towards metabolic syndrome. Drug Discov. Today, 13: 211-218. Park, K.H., J.R. Kim, J.S. Lec, H. Lec and K.H. Cho, 2010. Ethanol and water extract of purple sweet potato exhibits anti-atherosclerotic activity and inhibits protein glycation. J. Med. Food, 13: 91-98. Shklyaev, S. G. Aslandi, M. Terman, V. Prima aril E. Kohlbrenner et al., 2003. Sustained peripheral expression of transgene adiponectin offsets the development of diet-induced obesity in rats. Proc. Natl. Acad. Sci. USA., 100: 14217-14222. 48

[Find the meaning and references behind the names: Zhang, Waki, Saha, Kubota, Wang, Roots, Yamaguchi, Tsao, Metab, Ito, Yamada, Meng, Yan, Kamon]

Int. J. Pharmacol., 9 (1): 42-49, 2013 Tomas, E., T.S. Tsao, A.K. Saha, H.F. Murrey and C.C. Zhang et al., 2002. Enhanced muscle fat oxidation and glucose transport by ACRP30 globular domain: Acetyl-CoA carboxylase inhibition and AMP activated protein kinase activation. PNAS. 99: 16309-16313. Tononoz, P., E. Hu and B.M. Spiegelman, 1994. Stimulation of adipogenesis in fibroblasts by PPAR gamma 2, a lipid-activated transcription factor. Cell, 79: 1147-1156. Unger, R.II., 2003. Lipid overload and overflow: Metabolic and the metabolic syndrome. Trends Endocrinol Metab. 14: 398-403. Unger. R.H., 2004. obesity-regulator 117: 145-116. The hyperleptinemia of of calorie surpluses. Cell. Yamauchi, T., J. Kamon, H. Waki, Y. Terauchi and N. Kubota et al., 2001. The fat-derived hormone adiponectin reverses insulin resistance associated with both lipoatrophy and obesity. Nat.. Med., 7: 941-946. Yamauchi, T., J. Kamon, Y. Minokoshi, Y. Ito and H. Waki et al., 2002. Adiponectin stimulates glucose utilization and fatty acid oxidation activating AMP-activated protein kinase. Nat. Med., 8: 1288-1295. by on Ye, J., X. Meng, C. Yan and C. Wang, 2010. Effect of purple sweek. polato anthocyanins B-amyloid-mediated PC-12 cells death by inhibition of oxidative stress. Neurochem. Res., 35: 357-365. Yoshimoto, M., S. Okuno, M. Yoshinaga, O. Yamakawa, M. Yamaguchi and J. Yamada, 1999. Antimulagenicity of sweetpotato (Ipomoea batatas) roots. Biosci. Biotechnol. Biochem., 63: 537-541. 49

Other Health Sciences Concepts:

[back to top]

Discover the significance of concepts within the article: ‘Aqueous Extracts of Purple Sweet Potato Attenuate Weight Gain in High Fat-fed...’. Further sources in the context of Health Sciences might help you critically compare this page with similair documents:

Ast, Cancer, Liver, Glucose, Primer, Drinking water, Food-intake, Boiling water, Natural product, Adipose Tissue, Insulin, Obesity, Food consumption, Statistical analysis, Insulin resistance, LDL cholesterol, HDL cholesterol, Total cholesterol, Serum lipid profile, One-way ANOVA, Serum lipid levels, Stroke, Orlistat, Aqueous extract, Hypertension, Body weight gain, Free fatty acid, Fasting blood glucose, Coronary heart disease, Body weight, Antioxidant, Biochemical analysis, Antiobesity activity, Lipid metabolism, Body fat percentage, Dietary supplement, Normal diet, Serum triglyceride, Insulin sensitivity, Serum glucose level, Diet-induced obesity, Pancreatic lipase, Biochemical autoanalyzer, High-fat diet, Myocardial infarction, Inferior vena cava, Memory Enhancing Effect, Triglyceride synthesis, Antiobesity effect, Adipocyte Hypertrophy, Fat content, Intestinal absorption, Visceral fat, Hepatic steatosis, Fatty liver, Energy expenditure, Mitochondria, Glucose homeostasis, RNA isolation, Cardiovascular side-effects, High fat food, Reduced pressure, Leptin, Adipocytokines, Oral gavage, Cholesterol synthesis, ELISA kit, Muscle tissue, Real-time RT-PCR, Transcription factor, Antimutagenic, Liver weight, Adiposity, Fatty acid synthase, Blood lipid profile, Feed efficiency ratio, High-fat diet (HFD), Lipid lowering effect, Fatty acid oxidation, Adiponectin, Health benefit, Anthocyanin, Fatty acid transport, Lipid synthesis, Lipid homeostasis, De novo lipogenesis, Fat mass, Feed Efficiency Ratio (FER), Acetaminophen-induced liver damage, Cytokine secretion, CDNA, Glucose-lowering effects, Fatty acid synthesis, Non-HDL cholesterol, HOMA-IR score, AMP-Activated Protein Kinase (AMPK), Serum insulin level, Institutional animal care and use committee, Human macrophages, SREBP-1c, ALT, AMPK activation, Adipocyte, SREBP, High-fat fed mice, Annealing, Denaturation, Hepatic lipid accumulation, Sterol regulatory element-binding protein, Dietary regulation, Purple sweet potato, Isopropanol, Adipose tissue mass, Serum leptin level, SREBP-2, Lipogenic genes, SREBP-1, Acetyl-CoA carboxylase, National Research Foundation of Korea, Glucose-lowering effect, Primer Express software, Duncan's test, Serum adiponectin level.